Apod (NM_001301353) Mouse Untagged Clone
CAT#: MC226166
Apod (untagged) - Mouse apolipoprotein D (Apod), transcript variant 2
"NM_001301353" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Apod |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226166 representing NM_001301353
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGACCATGCTGATGTTCCTGGCCACGCTGGCGGGTCTCTTCACCACAGCCAAAGGACAAAATTTCC ATCTTGGGAAATGCCCGTCTCCTCCTGTGCAAGAGAATTTTGACGTGAAAAAGTATCTTGGAAGATGGTA CGAAATTGAGAAGATCCCAGCGAGCTTTGAGAAAGGAAACTGCATTCAAGCCAACTACTCGCTGATGGAG AACGGAAACATCGAAGTGCTAAACAAGGAGCTGAGTCCTGATGGAACCATGAACCAAGTAAAGGGTGAAG CCAAACAGAGCAACGTCTCAGAGCCAGCCAAGCTGGAAGTCCAGTTCTTCCCGTTGATGCCACCGGCACC CTACTGGATCCTGGCCACCGATTATGAAAACTATGCCCTCGTGTACTCCTGCACCACCTTCTTCTGGCTC TTCCATGTGGATTTTGTTTGGATTCTTGGAAGAAATCCTTATCTCCCTCCAGAAACAATAACCTACCTAA AAGATATCCTTACTTCTAATGGCATCGACATCGAAAAAATGACAACAACAGATCAAGCGAACTGCCCGGA CTTCCTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301353 |
Insert Size | 570 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301353.1, NP_001288282.1 |
RefSeq Size | 2070 bp |
RefSeq ORF | 570 bp |
Locus ID | 11815 |
UniProt ID | P51910 |
Cytogenetics | 16 21.41 cM |
Gene Summary | The protein encoded by this gene is a component of high-density lipoprotein (HDL), but is unique in that it shares greater structural similarity to lipocalin than to other members of the apolipoprotein family, and has a wider tissue expression pattern. The encoded protein is involved in lipid metabolism, and ablation of this gene results in defects in triglyceride metabolism. Elevated levels of this gene product have been observed in multiple tissues of Niemann-Pick disease mouse models, as well as in some tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228377 | Apod (myc-DDK-tagged) - Mouse apolipoprotein D (Apod), transcript variant 2 |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review