Eif4e1b (NM_001286180) Mouse Untagged Clone

CAT#: MC226162

Eif4e1b (untagged) - Mouse eukaryotic translation initiation factor 4E family member 1B (Eif4e1b), transcript variant 5

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Eif4e1b
• Synonyms: Eif4eloo; Gm273
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226162 representing NM_001286180
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCACTTCTGAGATGAACAAAGTTGAGGGTGGAGGGCATAAGGAGGAGGTGGTGGTGAAAGAAAAGG
  AGGTAGTGAAAGAAAAGCCATCAGAAGCAACTGCGGAGGGAGTCCAAGCAGGAGAAGCCAAAGACCTTCC
  TGGCTCCCTTAAGACTCAGAGGAGGAAGGCCCACAGAGAACATCCACCAGAGGTCCTGAGCAAGCTACAC
  CCCTTGCAGTACAGGTGGGTTCTGTGGTTCTTCAAGAATGACCGAAGCCGGGCCTGGCAGGACAACCTGC
  AGCTAGTCACCAAGTTTAACACTGTGGAGGACTTCTGGGCGGTGTACAGCCATATCAAGCTGGCCAGCAA
  GCTCTCTTCCGGCTGTGACTATGCCCTGTTCAAGGAAGGCATCCTGCCCATGTGGGAAGACAACAGAAAC
  AAGCAGGGTGGCCGCTGGCTGCTCAGCATTGACAAACAACTGCGCCACTTCGAACTGGACCGTCTGTGGC
  TGGAGACGCAGGGAAGTGTGCGGTGCTGTCGTGAACATCCGCACGAAGAGGGACAAGATTGCCCTGTGGA
  CGAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286180
• Insert Size: 567 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286180.1, NP_001273109.1
• RefSeq Size: 1810 bp
• RefSeq ORF: 567 bp
• Locus ID: 218268
• UniProt ID: Q3UTA9
• Cytogenetics: 13 B1
• Gene Summary: Recognizes and binds the 7-methylguanosine-containing mRNA cap during an early step in the initiation of protein synthesis and facilitates ribosome binding by inducing the unwinding of the mRNAs secondary structures.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (5) uses alternate splice sites in the 5'-terminal exon and in the 3' coding region, and initiates translation from an alternate start codon, compared to variant 1. The encoded isoform (5) has a longer N-terminus and a distinct C-terminus, compared to isoform 1.