Tlcd2 (NM_001291156) Mouse Untagged Clone

CAT#: MC226161

Tlcd2 (untagged) - Mouse TLC domain containing 2 (Tlcd2), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tlcd2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226161 representing NM_001291156
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCATCCTGGGGACTCCTTGTGGCTGGCGCTTCCTTCACGGCGTTTCGGGGACTGCACTGGGGGCTGC
  AGCTGCTGCCCACCCCGAAATCTGTTCGGGACCGCTGGATGTGGCGGAACATTTTCGTTTCGCTGATACA
  CAGCCTACTCTCTGGAGTAGGGGCGCTGGTCGGGCTGTGGCAGTTTCCTCAAATGGTCACCGACCCAATT
  AATGATCACCCACCGTGGGCACGGGTCCTAGTAGCAGTGTCAGTGGGTTATTTCGCTGCAGATGGAGTTG
  ATATGCTGTGGAACCAGACATTGGCCCAGGCCTGGGACCTTCTCTGTCACCATTTGGCGGTAGTGAGCTG
  CCTCAGCACCGCTGTTGTGTCTGGCCACTATGTGGGCTTCTCTATGGTATCCCTGCTTCTGGAGCTGAAC
  TCCATCTGTTTGCATCTACGGAAGCTACTGCTGCTCTCCCATAAGGCCCCATCCTTGGCCTTCAGAGCTC
  CAGATACCTGTACTCCACTGCTGCTGCTGCTCTTGGTGGTCATCTCATGGTACTGGCATCTCCAAAACGC
  TGCATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291156
• Insert Size: 567 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291156.1, NP_001278085.1
• RefSeq Size: 1141 bp
• RefSeq ORF: 567 bp
• Locus ID: 380712
• UniProt ID: Q8VC26
• Cytogenetics: 11 B5
• Gene Summary: Regulates the composition and fluidity of the plasma membrane (By similarity). Inhibits the incorporation of membrane-fluidizing phospholipids containing omega-3 long-chain polyunsaturated fatty acids (LCPUFA) and thereby promotes membrane rigidity (By similarity). Does not appear to have any effect on LCPUFA synthesis (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.