Rgr (NM_001301694) Mouse Untagged Clone

CAT#: MC226132

Rgr (untagged) - Mouse retinal G protein coupled receptor (Rgr), transcript variant 3

  View "NM_001301694" in other vectors (1)

USD 200.00


Availability*
2 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Rgr (NM_001301694) Mouse Untagged Clone
Symbol Rgr
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC226132 representing NM_001301694
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCTTGTTGCAGCGGTATCCAGCCTCCTCCGGCAGACAGTTGGCATGGGACACGGCCATCCCTCTGG
TGCTGTTTGTGTGGATGTCATCTGCCTTCTGGGCATCCCTGCCCCTGATGGGCTGGGGCCACTATGACTA
TGAGCCTGTGGGGACATGCTGTACACTGGACTATTCGAGGGGTGACAGAAACTTCATCAGTTTTCTCTTC
ACCATGGCTTTTTTCAACTTCCTCGTACCCCTGTTCATCACACACACTTCATACCGGTTCATGGAGCAGA
AATTCTCCAGGAGTGGCCATCTCCCGGTGAATACTACTCTTCCAGGCAGAATGCTGCTGCTTGGCTGGGG
CCCCTATGCCCTCCTGTACCTATACGCAGCCATCGCAGATGTGAGCTTCATCTCTCCTAAACTACAGATG
GTGCCTGCTCTCATCGCCAAAACCATGCCCACAATCAACGCCATCAACTATGCGTTGCACAGGGAGATGG
TCTGTAGAGGAACCTGGCAGTGTCTGTCTCCACAAAAAAGCAAGAAGGACCGAACCCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001301694
ORF Size 552 bp
Insert Size 552
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001301694.1, NP_001288623
RefSeq Size 4135
RefSeq ORF 552
Locus ID 57811
Cytogenetics 14|14 B
Gene Summary The gene is a member of the opsin family of G-protein coupled receptors. The encoded protein is expressed in the retina, and acts as a photoisomerase to catalyze the conversion of all-trans-retinal to 11-cis-retinal. Disruption of a similar gene in human is associated with autosomal recessive (arRP) and autosomal dominant retinitis pigmentosa (adRP). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]

Other Versions

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones