Rgr (NM_001301694) Mouse Untagged Clone

CAT#: MC226132

Rgr (untagged) - Mouse retinal G protein coupled receptor (Rgr), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rgr
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226132 representing NM_001301694
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCCTTGTTGCAGCGGTATCCAGCCTCCTCCGGCAGACAGTTGGCATGGGACACGGCCATCCCTCTGG
  TGCTGTTTGTGTGGATGTCATCTGCCTTCTGGGCATCCCTGCCCCTGATGGGCTGGGGCCACTATGACTA
  TGAGCCTGTGGGGACATGCTGTACACTGGACTATTCGAGGGGTGACAGAAACTTCATCAGTTTTCTCTTC
  ACCATGGCTTTTTTCAACTTCCTCGTACCCCTGTTCATCACACACACTTCATACCGGTTCATGGAGCAGA
  AATTCTCCAGGAGTGGCCATCTCCCGGTGAATACTACTCTTCCAGGCAGAATGCTGCTGCTTGGCTGGGG
  CCCCTATGCCCTCCTGTACCTATACGCAGCCATCGCAGATGTGAGCTTCATCTCTCCTAAACTACAGATG
  GTGCCTGCTCTCATCGCCAAAACCATGCCCACAATCAACGCCATCAACTATGCGTTGCACAGGGAGATGG
  TCTGTAGAGGAACCTGGCAGTGTCTGTCTCCACAAAAAAGCAAGAAGGACCGAACCCAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301694
• Insert Size: 552 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301694.1, NP_001288623.1
• RefSeq Size: 4135 bp
• RefSeq ORF: 552 bp
• Locus ID: 57811
• Cytogenetics: 14 B
• Gene Summary: The gene is a member of the opsin family of G-protein coupled receptors. The encoded protein is expressed in the retina, and acts as a photoisomerase to catalyze the conversion of all-trans-retinal to 11-cis-retinal. Disruption of a similar gene in human is associated with autosomal recessive (arRP) and autosomal dominant retinitis pigmentosa (adRP). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (3) uses an alternate splice site and lacks an alternate exon in the 5' coding region, and uses an alternate downstream start codon compared to variant 1. The resulting protein (isoform 2) has a distinct N-terminus and is shorter compared to isoform 1. Variants 2 and 3 encode the same isoform (2).