Srsf10 (NM_001284196) Mouse Untagged Clone
CAT#: MC226126
Srsf10 (untagged) - Mouse serine/arginine-rich splicing factor 10 (Srsf10), transcript variant 4
"NM_001284196" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Srsf10 |
Synonyms | Fusip1; FUSIP2; Nssr; NSSR1; NSSR2; Sfrs13a; SRrp40; Srsf13a; TASR; TASR1; TASR2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226126 representing NM_001284196
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCCGATACCTGCGCCCCCCTAACACGTCTCTGTTCGTCAGGAACGTGGCGGACGACACCAGGTCTG AAGATTTACGTCGGGAATTTGGTCGTTATGGTCCAATAGTAGATGTTTATGTCCCACTTGATTTCTACAC TCGGCGTCCAAGAGGATTTGCATATGTTCAATTTGAGGATGTTCGTGATGCTGAAGACGCTTTACATAAT TTGGACAGAAAATGGATTTGTGGGCGTCAGATTGAAATCCAGTTCGCACAGGGGGATCGGAAGACACCAA ATCAAATGAAAGCCAAGGAAGGGAGGAATGTATACAGCTCTTCACGATATGACGATTATGACCGATATAG ACGCTCTCGAAGCCGGAGTTATGAAAGGAGAAGATCGAGGAGTCGCTCCTTTGATTATAACTATAGGAGA TCTTACAGTCCTAGAAATAGACCGACTGGAAGACCACGGCGTAGCCGAAGCCATTCCGACAATGATAGAC CAAACTGCAGCTGGAATACCCAGTACAGTTCTGCTTACTACACTTCAAGAAAGATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001284196 |
Insert Size | 549 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001284196.1, NP_001271125.1 |
RefSeq Size | 3433 bp |
RefSeq ORF | 549 bp |
Locus ID | 14105 |
UniProt ID | Q9R0U0 |
Cytogenetics | 4 D3 |
Gene Summary | Splicing factor that in its dephosphorylated form acts as a general repressor of pre-mRNA splicing. Seems to interfere with the U1 snRNP 5'-splice recognition of SNRNP70. Required for splicing repression in M-phase cells and after heat shock. Also acts as a splicing factor that specifically promotes exon skipping during alternative splicing. Interaction with YTHDC1, a RNA-binding protein that recognizes and binds N6-methyladenosine (m6A)-containing RNAs, prevents SRSF10 from binding to its mRNA-binding sites close to m6A-containing regions, leading to inhibit exon skipping during alternative splicing (By similarity). May be involved in regulation of alternative splicing in neurons (PubMed:10583508).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 3' coding region and contains an alternate 3' terminal exon, compared to variant 2. It encodes isoform 4, which is shorter and has a distinct C-terminus, compared to isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228337 | Srsf10 (myc-DDK-tagged) - Mouse serine/arginine-rich splicing factor 10 (Srsf10), transcript variant 4 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review