Vamp7 (NM_001302138) Mouse Untagged Clone

CAT#: MC226116

Vamp7 (untagged) - Mouse vesicle-associated membrane protein 7 (Vamp7), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Vamp7
• Synonyms: Sybl1; TI-VAMP; VAMP-7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226116 representing NM_001302138
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTTGGTGTGGAGGAAACTTCCTGGAGTTATTTGTTTCATTACATCTGCCAAGACAGGATTGTGTATC
  TTTGTATCACTGATGATGATTTTGAGCGTTCTCGAGCGTTCAGTTTTTTGAATGAAGTAAAGAAGAGATT
  CCAGACAACTTACGGTTCAAGAGCACAAACTGCACTTCCTTATGCTATGAATAGCGAGTTTTCAAGTGTT
  TTGGCTGCACAACTGAAGCATCACTCTGAGAATAAGAGCCTAGACAAAGTGATGGAGACTCAAGCACAAG
  TGGATGAACTGAAAGGAATAATGGTCAGAAACATAGATTTAGTTGCTCAACGTGGAGAAAGGTTGGAATT
  GCTGATAGATAAAACAGAAAACCTTGTGGATTCATCTGTCACTTTCAAAACTACCAGCAGAAATCTTGCT
  CGAGCCATGTGTATGAAGAATATCAAGCTCACTATCATCATCATCATTGTATCAATTGTGTTCATCTATA
  TCATTGTGTCACTTCTCTGTGGTGGGTTTACATGGCCAAACTGTGTGAAGAAATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302138
• Insert Size: 546 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302138.1, NP_001289067.1
• RefSeq Size: 2530 bp
• RefSeq ORF: 546 bp
• Locus ID: 20955
• UniProt ID: P70280
• Cytogenetics: X
• Gene Summary: Involved in the targeting and/or fusion of transport vesicles to their target membrane during transport of proteins from the early endosome to the lysosome. Required for heterotypic fusion of late endosomes with lysosomes and homotypic lysosomal fusion. Required for calcium regulated lysosomal exocytosis. Involved in the export of chylomicrons from the endoplasmic reticulum to the cis Golgi. Required for exocytosis of mediators during eosinophil and neutrophil degranulation, and target cell killing by natural killer cells. Required for focal exocytosis of late endocytic vesicles during phagosome formation.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate splice site in the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus, compared to isoform 1.