Psma7 (NM_001289476) Mouse Untagged Clone
CAT#: MC226096
Psma7 (untagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 7 (Psma7), transcript variant 2
"NM_001289476" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Psma7 |
Synonyms | C6-I |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226096 representing NM_001289476
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCTTTGCAGGTCTCACCGCTGATGCAAGGATAGTCATCAACAGAGCCCGGGTAGAGTGCCAGAGCC ACCGGCTGACAGTGGAGGACCCAGTGACTGTGGAGTACATCACCCGCTACATTGCGAGTCTGAAGCAGCG TTATACACAGAGCAATGGGCGCAGGCCATTTGGTATCTCGGCCCTAATTGTGGGTTTTGACTTTGATGGC ACTCCCAGACTCTATCAGACTGACCCCTCGGGCACATACCATGCTTGGAAGGCCAATGCCATAGGCCGGG GCGCCAAGTCAGTGCGTGAATTTCTGGAGAAGAACTACACAGATGATGCCATTGAAACAGATGATCTGAC CATCAAACTTGTGATCAAGGCACTGTTAGAGGTGGTCCAGTCAGGTGGCAAAAACATCGAACTTGCCGTC ATGAGGCGGGATCAGCCGCTCAAGATTCTAAATCCTGAAGAAATTGAGAAGTATGTTGCTGAAATTGAGA AGGAGAAAGAAGAAAATGAAAAGAAGAAGCAAAAGAAAGCATCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289476 |
Insert Size | 537 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289476.1, NP_001276405.1 |
RefSeq Size | 1591 bp |
RefSeq ORF | 537 bp |
Locus ID | 26444 |
Cytogenetics | 2 H4 |
Gene Summary | Component of the 20S core proteasome complex involved in the proteolytic degradation of most intracellular proteins. This complex plays numerous essential roles within the cell by associating with different regulatory particles. Associated with two 19S regulatory particles, forms the 26S proteasome and thus participates in the ATP-dependent degradation of ubiquitinated proteins. The 26S proteasome plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins that could impair cellular functions, and by removing proteins whose functions are no longer required. Associated with the PA200 or PA28, the 20S proteasome mediates ubiquitin-independent protein degradation. This type of proteolysis is required in several pathways including spermatogenesis (20S-PA200 complex) or generation of a subset of MHC class I-presented antigenic peptides (20S-PA28 complex).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2, which has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228307 | Psma7 (myc-DDK-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 7 (Psma7), transcript variant 2 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review