Rangrf (NM_001285442) Mouse Untagged Clone
CAT#: MC226095
Rangrf (untagged) - Mouse RAN guanine nucleotide release factor (Rangrf), transcript variant 3
"NM_001285442" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Rangrf |
Synonyms | 2400006H24Rik; Mog1; Rangnrf |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226095 representing NM_001285442
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCCCAACAGAAACTGTCCACTGTTCGGAGGCGCCTTCTCCGCCATCCTCCCTACAGGGGCCATTG ATGTGAGTGACCTCCGACCGGTGCCAGACAACCAAGAAGTTTTCTGCCATCCTGTGACCGACCAGAGTCT GATCATAGAACTTCTGGAGCTGCAGGCCCACGTGCAGGGCGAAGCGGCTGCGCGGTACCATTTTGAGGAC GTTGGCCGGGTGCAGGGGGCTAGGGCTGTGCACGTGCTATCTGTGCAGCCTCTCTGTTTGGAGAACTTAT CCCTGAGAGGCTGCTGTCAGGATGCCTGGTCCCTTTCTGGCAAGCAGCAGGTAGCAAAGGATGTCACACT GCATCAGGCCTTGCTGCGGCTGCCCCAGTATCAGACTGATCTTTTGCTCACCTTCAATCAGCCCCCGTGT CACAGCAGGTCTCTTGGCCCTGAAAATCTGTCATGTCCACCTTGGAGCCTGAGTAACTTTGAACAGCTGG TAACTAGTTTGACTCTTCATGATCCCAACCTCTTTGGTCCCCAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001285442 |
Insert Size | 537 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001285442.1, NP_001272371.1 |
RefSeq Size | 824 bp |
RefSeq ORF | 537 bp |
Locus ID | 57785 |
Cytogenetics | 11 B3 |
Gene Summary | May regulate the intracellular trafficking of RAN (PubMed:10811801, PubMed:11733047). Promotes guanine nucleotide release from RAN and inhibits binding of new GTP by preventing the binding of the RAN guanine nucleotide exchange factor RCC1 (PubMed:10811801, PubMed:11733047). Regulates the levels of GTP-bound RAN in the nucleus, and thereby plays a role in the regulation of RAN-dependent mitotic spindle dynamics (By similarity). Enhances the expression of SCN5A at the cell membrane in cardiomyocytes (PubMed:18184654, PubMed:23420830).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and uses an alternate in-frame splice junction at the 3' end of an exon compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus and lacks an alternate internal segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228306 | Rangrf (myc-DDK-tagged) - Mouse RAN guanine nucleotide release factor (Rangrf), transcript variant 3 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review