Sirpa (NM_001291022) Mouse Untagged Clone
CAT#: MC226063
Sirpa (untagged) - Mouse signal-regulatory protein alpha (Sirpa), transcript variant 7
"NM_001291022" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Sirpa |
Synonyms | AI835480; Bit; CD172a; P84; Ptpns1; SHP-1; SHPS-1; SIRP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226063 representing NM_001291022
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCCCGCCGGCCCGGCCCCTGGCCGCCTAGGGCCGCTGCTGCTCTGCCTGCTGCTCTCCGCGTCCT GTTTCTGTACAGATAATAATGCTACCCACAACTGGAATGTCTTCATCGGTGTGGGCGTGGCGTGTGCTTT GCTCGTAGTCCTGCTGATGGCTGCTCTCTACCTCCTCCGGATCAAACAGAAGAAAGCCAAGGGGTCAACA TCTTCCACACGGTTGCACGAGCCCGAGAAGAACGCCAGGGAAATAACCCAGATCCAGGACACAAATGACA TCAACGACATCACATACGCAGACCTGAATCTGCCCAAAGAGAAGAAGCCCGCACCCCGGGCCCCTGAGCC TAACAACCACACAGAATATGCAAGCATTGAGACAGGCAAAGTGCCTAGGCCAGAGGATACCCTCACCTAT GCTGACCTGGACATGGTCCACCTCAGCCGGGCACAGCCAGCCCCCAAGCCTGAGCCATCTTTCTCAGAGT ATGCTAGTGTCCAGGTCCAGAGGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291022 |
Insert Size | 519 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291022.1, NP_001277951.1 |
RefSeq Size | 3020 bp |
RefSeq ORF | 519 bp |
Locus ID | 19261 |
Cytogenetics | 2 63.19 cM |
Gene Summary | Immunoglobulin-like cell surface receptor for CD47. Acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. Supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. May play a key role in intracellular signaling during synaptogenesis and in synaptic function. Involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. Mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation. CD47 binding prevents maturation of immature dendritic cells and inhibits cytokine production by mature dendritic cells (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (7) lacks an alternate in-frame exon in the 5' coding region and two in-frame exons in the central coding region, and also uses an alternate in-frame splice site in the 3' coding region, compared to variant 4. The encoded isoform (5) is shorter than isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228274 | Sirpa (myc-DDK-tagged) - Mouse signal-regulatory protein alpha (Sirpa), transcript variant 7 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review