Vps25 (NM_001284412) Mouse Untagged Clone

CAT#: MC226059

Vps25 (untagged) - Mouse vacuolar protein sorting 25 (yeast) (Vps25), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Vps25
• Synonyms: 1110020N13Rik; AW107467; D11Wsu68e
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226059 representing NM_001284412
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGATGAGTTTCGAGTGGCCGTGGCAGTACCGCTTCCCGCCCTTCTTTACGTTACAGCCGAACGTGG
  ACACCCGGCAGAAGCAGCTGGCCGCCTGGTGCTCTCTGGTTCTGTCCTTCTGCCGCCTGCACAAACAGTC
  CAGCATGACGGTGATGGAAGCCCAGGAGAGCCCGCTTTTCAACAACGTCAAGCTACAGCGGAAACTTCCT
  GTGGAGTCAATTCAGATTGTATTAGAAGAACTGAGAAAGAAAGGGAACCTCGAGTGGTTGGATAAGAATA
  AGTCTAGCTTCCTGATCATGTGGCGGAGGCCAGAAGAATGGGGGAAACTCATTTACCAATGGGTTTCCAG
  GAGTGGCCAGAATAACTCTGTGTTTACTCTGTATGAACTGACGAGTGGGGAAGACACAGAGGATGAAGGA
  ATGCCCAGGAATTGTGAGGCACAGCTGCAGCAGTGCACACAGCATACAAATAGATTATCCTGGCTTTGGA
  AGTCTCAGCTTCTGGCTCAGCCACAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001284412
• Insert Size: 519 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001284412.1, NP_001271341.1
• RefSeq Size: 1259 bp
• RefSeq ORF: 519 bp
• Locus ID: 28084
• Cytogenetics: 11 64.48 cM
• Gene Summary: Component of the ESCRT-II complex (endosomal sorting complex required for transport II), which is required for multivesicular body (MVB) formation and sorting of endosomal cargo proteins into MVBs. The MVB pathway mediates delivery of transmembrane proteins into the lumen of the lysosome for degradation. The ESCRT-II complex is probably involved in the recruitment of the ESCRT-III complex. The ESCRT-II complex may also play a role in transcription regulation, possibly via its interaction with ELL (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) uses alternate splice junctions at the 5' ends of two different exons compared to variant 1. The resulting isoform (3) lacks an alternate internal segment and has a shorter and distinct C-terminus compared to isoform 1.