Clasp2 (NM_001286603) Mouse Untagged Clone
CAT#: MC226038
Clasp2 (untagged) - Mouse CLIP associating protein 2 (Clasp2), transcript variant 8
"NM_001286603" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Clasp2 |
Synonyms | 1500004F14Rik; 8030404L10Rik; C77448; CLASP2beta; mKIAA0627 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226038 representing NM_001286603
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTATGGGAGATGATAAAAGCTTTGATGATGAGGAATCAGTGGATGGAAATAGGCCGTCGTCAGCTG CTTCAGCCTTCAAGGTTCCTGCACCTAAAACACCTGGGAATCCTGTCAGCAGTGCAAGAAAGCCTGGCTC AGCAGGTGGCCCTAAGGTTGGAGGTCCTTCTAAAGAAGGAGGGGCTGGAGCAGTTGATGAAGATGACTTT ATAAAAGCTTTTACAGATGTTCCTTCTGTTCAGATCTATTCTAGTCGAGAACTTGAAGAGACGTTAAATA AGATCAGGGAAATTTTGTCAGATGACAAACATGACTGGGACCAGCGTGCCAATGCGTGCATGTCCTGCAG CCTGGTAGCCAGTGAGGTTGAGAGAGCTCTGGCCTGGCCTCTGTGGAGTCACCTAGCTACTTATCAGCAC CATTGTCATTGCACCCTGAGTCATGAGGACTTGCCAGAGAAGAGATTGACTTCTCCTGTGAGCTCGGCAT TTGTTCAACATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286603 |
Insert Size | 504 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001286603.1, NP_001273532.1 |
RefSeq Size | 1493 bp |
RefSeq ORF | 504 bp |
Locus ID | 76499 |
UniProt ID | Q8BRT1 |
Cytogenetics | 9 F3 |
Gene Summary | Microtubule plus-end tracking protein that promotes the stabilization of dynamic microtubules. Involved in the nucleation of noncentrosomal microtubules originating from the trans-Golgi network (TGN). Required for the polarization of the cytoplasmic microtubule arrays in migrating cells towards the leading edge of the cell. May act at the cell cortex to enhance the frequency of rescue of depolymerizing microtubules by attaching their plus-ends to cortical platforms composed of ERC1 and PHLDB2. This cortical microtubule stabilizing activity is regulated at least in part by phosphatidylinositol 3-kinase signaling. Also performs a similar stabilizing function at the kinetochore which is essential for the bipolar alignment of chromosomes on the mitotic spindle. Acts as a mediator of ERBB2-dependent stabilization of microtubules at the cell cortex.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (8) differs in both UTR's and the coding region but maintains the reading frame, compared to variant 3. This results in a protein (isoform h) that is shorter at both the N- and C-termini, compared to isoform c. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228249 | Clasp2 (myc-DDK-tagged) - Mouse CLIP associating protein 2 (Clasp2), transcript variant 8 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review