Cxadr (NM_001276263) Mouse Untagged Clone

CAT#: MC226027

Cxadr (untagged) - Mouse coxsackie virus and adenovirus receptor (Cxadr), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cxadr
• Synonyms: 2610206D03Rik; AU016810; AW553441; C; CAR; MC; MCAR; MCV; MCVADR
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226027 representing NM_001276263
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGCGCCTACTGTGCTTCGTGCTCTTGTGCGGGATCGCGGATTTCACCAGTGGTTTGAGCATCACTA
  CACCCGAACAGAGGATCGAAAAAGCCAAAGGGGAAACTGCGTATCTACCATGCAAGTTTACTCTCAGTCC
  CGAAGACCAGGGACCACTGGACATTGAATGGCTGATATCCCCGTCTGATAACCAGATAGTGGATCAAGTG
  ATCATTTTGTATTCTGGAGACAAAATTTATGATAACTACTATCCGGATCTGAAAGGACGGGTACATTTTA
  CGAGTAACGATGTCAAGTCTGGCGACGCATCTATAAATGTGACCAACCTGCAGCTGTCGGACATTGGCAC
  TTACCAGTGCAAAGTGAAGAAAGCCCCTGGGGTTGCAAATAAGAAATTCCTGCTGACCGTTCTTGGTAAG
  TCATCGTTCCTATTATCCACAGGGGTGGAGTGGGGTGGGGGTGCGGAGTTACAAGGTGGCAGGGAAGGTG
  GCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276263
• Insert Size: 495 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001276263.1, NP_001263192.1
• RefSeq Size: 1386 bp
• RefSeq ORF: 495 bp
• Locus ID: 13052
• UniProt ID: P97792
• Cytogenetics: 16 C3.1
• Gene Summary: This gene encodes a protein that is part of the Cortical Thymocyte marker in Xenopus (CTX) subfamily within the immunoglobulin superfamily. Members of this subfamily, predominantly expressed on the surface of endothelial and epithelial cells, help establish cell polarity and provide a barrier function, regulating migration of immune cells. This protein, first identified as the receptor for adenovirus subgroup C and coxsakieviruses group B, is developmentally regulated and plays an important role in cardiac development. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (3) includes an alternate terminal 3' exon and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. The encoded isoform (c) has a distinct and shorter C-terminus, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.