Trp53inp1 (NM_001199105) Mouse Untagged Clone

CAT#: MC226021

Trp53inp1 (untagged) - Mouse transformation related protein 53 inducible nuclear protein 1 (Trp53inp1), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Trp53inp1
• Synonyms: 2700057G22Rik; SIP; SIP18; SIP27; Stinp; Teap
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226021 representing NM_001199105
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTTCAGAGACTGAATAAAATGTTTGTAGGCGAAGTCACTACTTCTTCCAGCCAAGAACCAGAATTCA
  GTGAGAAAGAAGATGATGAATGGATTCTTGTTGACTTCATAGATACCTGCCCTGGTTTCTCAGCAGAGGA
  AGAGGAAGAAGATGAAGACATTGGTGAAGAGTCCTCAGCAGAGCACACTTCTGTCTTCTCCTGTTTACCT
  GCATCTTTGGAATGCTTGACTGACACCAGTGATTCCTGCTTCCTTCAGTTTGAGTCCTGTCCAATGGAGG
  AGAGCTGGTTCATCACTCCTCCCCCATGTTTTACAGCAGGTGGATTAACCACTATCAAGGTGGAAACAAG
  TCCTATGGAAAACCTTCTCATTGAACATCCCAGCATGTCTGTCTATGCTGTGCACAACTCCTGTCCTGGT
  CTCAGTGAGGCGAGTTGTGGAAATGATGAATATAACTCAAGTGGTCCCAGGGCCAGAAAAAGCTGCTTAT
  AA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199105
• Insert Size: 492 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199105.1, NP_001186034.1
• RefSeq Size: 5430 bp
• RefSeq ORF: 492 bp
• Locus ID: 60599
• UniProt ID: Q9QXE4
• Cytogenetics: 4 A1
• Gene Summary: Antiproliferative and proapoptotic protein involved in cell stress response which acts as a dual regulator of transcription and autophagy. Acts as a positive regulator of autophagy. In response to cellular stress or activation of autophagy, relocates to autophagosomes where it interacts with autophagosome-associated proteins GABARAP, GABARAPL1/L2, MAP1LC3A/B/C and regulates autophagy. Acts as an antioxidant and plays a major role in p53/TP53-driven oxidative stress response. Possesses both a p53/TP53-independent intracellular reactive oxygen species (ROS) regulatory function and a p53/TP53-dependent transcription regulatory function. Positively regulates p53/TP53 and p73/TP73 and stimulates their capacity to induce apoptosis and regulate cell cycle. In response to double-strand DNA breaks, promotes p53/TP53 phosphorylation on 'Ser-46' and subsequent apoptosis. Acts as a tumor suppressor by inducing cell death by an autophagy and caspase-dependent mechanism. Can reduce cell migration by regulating the expression of SPARC.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) has an additional exon in the coding region which results in a frameshift and early stop codon, compared to variant 1. It encodes a shorter isoform (2; also known as SIP18) with a distinct C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.