Alkbh7 (NM_027372) Mouse Untagged Clone

CAT#: MC226019

Alkbh7 (untagged) - Mouse alkB, alkylation repair homolog 7 (E. coli) (Alkbh7), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Alkbh7
• Synonyms: 2310045B01Rik; 2510008E23Rik; Abh7; Spata11
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226019 representing NM_027372
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGGGCAGCAGGAGGCTAGCGATGCGGTTGCTTTCTGGGTGCGCCTGGGTGCGCGGCTCAGACTCTG
  CCGTGCTGGGCCGCCTGCGTGATGAGGCCGTGGTGCATCCAGGCTTCCTGAGCCAGGAGGAGGAGGACAC
  GCTAACACGCGAACTGGAGCCCCAGCTGCGGCGCCGGCGCTACGAGTACGACCACTGGGACGCGTTCTGT
  GGATCTACCATTGCTGGCCTTTCCCTGTTGTCTCCAAGTGTTATGAAGCTGGTGCATACACAGGAACCTG
  AGCAGTGGCTGGAACTGTTGCTGGAGCCAGGGTCTCTCTATATCTTAAGGGGTTCAGCCCGATATGACTT
  CTCCCATGAGATCCTTAGAGATGAAGAATCATTTTTTGGGGAGCACCGGGTTCCCCGGGGCCGACGCATC
  TCAGTGATTTGCCGCTCCCTCCCTGAGGGGATGGGGCCAGGAAGGCCAGAAGAGCCACCTCCAGCCTGCT
  GA
  
  AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
  TGGATTACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-RsrII
• ACCN: NM_027372
• Insert Size: 492 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_027372.1, NP_081648.1
• RefSeq Size: 765 bp
• RefSeq ORF: 492 bp
• Locus ID: 66400
• UniProt ID: Q9D6Z0
• Cytogenetics: 17 D
• Gene Summary: May function as protein hydroxylase; can catalyze auto-hydroxylation at Leu-110 (in vitro), but this activity may be due to the absence of the true substrate. Required to induce programmed necrosis in response to DNA damage caused by cytotoxic alkylating agents. Acts by triggering the collapse of mitochondrial membrane potential and loss of mitochondrial function that leads to energy depletion and cell death. ALKBH7-mediated necrosis is probably required to prevent the accumulation of cells with DNA damage. Does not display DNA demethylase activity (By similarity). Involved in fatty acid metabolism.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1. The resulting isoform (2) lacks an internal protein segment compared to isoform 1.