Jdp2 (NM_001205052) Mouse Untagged Clone

CAT#: MC226017

Jdp2 (untagged) - Mouse Jun dimerization protein 2 (Jdp2), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Jdp2
• Synonyms: Jundm2; Jundp2; TIF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226017 representing NM_001205052
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGCCTGGGCAGATCCCAGACCCTTCAGTGACCGCAGGCTCTCTGCCAGGGCTCGGCCCCCTCACCG
  GACTTCCCAGCTCTGCTCTGACCACAGAGGAGCTGAAATACGCTGACATCCGCAACATTGGGGCGATGAT
  TGCGCCCTTGCACTTCCTGGAGGTGAAACTGGGCAAGAGGCCCCAACCCGTGAAGAGTGAGCTAGACGAG
  GAAGAAGAGCGAAGGAAAAGGCGCCGGGAAAAGAACAAAGTCGCTGCAGCCAGATGCCGGAACAAGAAGA
  AGGAACGCACAGAGTTTCTGCAGAGGGAGTCAGAGCGGCTGGAGCTCATGAACGCAGAGCTGAAGACGCA
  GATAGAGGAGCTGAAGCTGGAGCGGCAACAGCTTATCCTGATGCTCAACCGCCACCGCCCCACCTGCATC
  GTGCGCACAGATAGCGTCAGGACGCCCGAGTCCGAAGGCAACCCACTGCTGGAGCAGCTGGACAAGAAGT
  GA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001205052
• Insert Size: 492 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001205052.1, NP_001191981.1
• RefSeq Size: 1567 bp
• RefSeq ORF: 492 bp
• Locus ID: 81703
• UniProt ID: P97875
• Cytogenetics: 12 D2
• Gene Summary: Component of the AP-1 transcription factor that represses transactivation mediated by the Jun family of proteins. Involved in a variety of transcriptional responses associated with AP-1, such as UV-induced apoptosis, cell differentiation, tumorigenesis and antitumogeneris. Can also function as a repressor by recruiting histone deacetylase 3/HDAC3 to the promoter region of JUN. May control transcription via direct regulation of the modification of histones and the assembly of chromatin (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.