Avpr2 (NM_001276299) Mouse Untagged Clone

CAT#: MC225993

Avpr2 (untagged) - Mouse arginine vasopressin receptor 2 (Avpr2), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Avpr2
• Synonyms: ADHR; DI; DI1; DIR; ND; ND1; V; V2R; VPV2R
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225993 representing NM_001276299
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATCCTGGTGTCTACCACGTCTGGCATTGCTGCCTGCCAGGTTCTTATCTTCCGGGAGATACATGCCA
  GTCTGGTGCCAGGGCCATCTGAAAGGGCAGGGAGGCGCCGCAGAGGACACCGGACAGGAAGTCCCAGCGA
  GGGAGCCCATGTATCAGCAGCCATGGCCAAGACCGTGAGGATGACACTGGTGATTGTGATTGTCTACGTG
  CTGTGCTGGGCACCCTTCTTCCTTGTGCAGCTGTGGGCAGCGTGGGATCCAGAAGCTCCTCTGGAAAGAC
  CCCCCTTTGTGTTGCTCATGCTGCTGGCTAGCCTTAACAGCTGTACCAACCCCTGGATCTATGCTTCCTT
  CAGTAGCAGTGTCTCCTCGGAGTTGCGTAGCCTGCTTTGCTGTGCTCAGAGGCACACCACACACAGCCTG
  GGTCCTCAAGATGAGTCCTGTGCCACAGCCAGCTCCTCTCTGATGAAGGATACACCCTCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276299
• Insert Size: 483 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001276299.1, NP_001263228.1
• RefSeq Size: 1179 bp
• RefSeq ORF: 483 bp
• Locus ID: 12000
• Cytogenetics: X 37.46 cM
• Gene Summary: This gene encodes a member of the G-protein coupled receptor 1 family and the vasopressin/oxytocin receptor subfamily. The encoded protein is an arginine vasopressin receptor which, when stimulated, activates the Gs protein/adenylyl cyclase signaling cascade and is involved in water and electrolyte homeostasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (3) uses an alternate in-frame splice site in the coding region, compared to variant 1. It encodes a shorter protein (isoform c) compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.