Hikeshi (NM_001291287) Mouse Untagged Clone
CAT#: MC225976
l7Rn6 (untagged) - Mouse lethal, Chr 7, Rinchik 6 (l7Rn6), transcript variant 3
"NM_001291287" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Hikeshi |
Synonyms | 0610007P06Rik; 1110002N09Rik; l(7)6Rn; l7Rn6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225976 representing NM_001291287
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGGGAACAATCCCATTTCCTGAGGGCATGGGAGGATCTGTCTACTTTTCCTATCCTGATTCAAATG GGGTGCCAGTGTGGCAGCTCCTAGGATTTGTCACGAATGGAAAGCCAAGTGCCATCTTCAAAATATCAGG TCTTAAATCTGGGGAAGGAAGCCAGCACCCATTTGGAGCCATGAATATTGTGCGAACCCCATCTGTTGCC CAGATTGGCATCTCGGTGGAATTGTTGGACAGTCTGGCTCAGCAGACTCCTGTAGGCAGTGCTGCCGTGT CCTCCGTTGACTCCTTTACGCAGTTCACACAGAAGATGTTGGACAACTTCTACAATTTTGCTTCATCATT TGCTCTCTCTCAGGCCCAGATGACACCAAATCCATCAGAAATGTTCATCCCAGCAAATGTGGTTCTGAAA TGGTATGAAAACTTTCAAAGACGACTAGCACAGAACCCCCTCTTTTGGAAAACATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291287 |
Insert Size | 477 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291287.1, NP_001278216.1 |
RefSeq Size | 1149 bp |
RefSeq ORF | 477 bp |
Locus ID | 67669 |
UniProt ID | Q9DD02 |
Cytogenetics | 7 50.4 cM |
Gene Summary | Acts as a specific nuclear import carrier for HSP70 proteins following heat-shock stress: acts by mediating the nucleoporin-dependent translocation of ATP-bound HSP70 proteins into the nucleus. HSP70 proteins import is required to protect cells from heat shock damages. Does not translocate ADP-bound HSP70 proteins into the nucleus (By similarity). May also be indirectly required for organization and/or function of the secretory apparatus in Clara cells in lung.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) contains an alternate exon and initiates translation at an alternate start codon compared to variant 1. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228187 | l7Rn6 (myc-DDK-tagged) - Mouse lethal, Chr 7, Rinchik 6 (l7Rn6), transcript variant 3 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review