Ap1s2 (NM_001290378) Mouse Untagged Clone
CAT#: MC225972
Ap1s2 (untagged) - Mouse adaptor-related protein complex 1, sigma 2 subunit (Ap1s2), transcript variant 2
"NM_001290378" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ap1s2 |
Synonyms | 1500012A13Rik; AI853648; EST1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225972 representing NM_001290378
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGTTTATGTTGCTTTTTAGTCGCCAGGGAAAGCTTCGACTGCAGAAATGGTATGTCCCACTGTCAG ACAAAGAAAAGAAGAAGATCACAAGAGAACTTGTTCAAACCGTTTTAGCACGGAAACCCAAGATGTGCAG CTTCCTTGAGTGGAGAGATCTGAAGATTGTTTATAAAAGATATGCCAGTCTATATTTTTGCTGTGCTATT GAGGATCAGGACAATGAACTGATTACCCTGGAAATAATCCATCGTTACGTGGAATTACTTGACAAGTATT TTGGCAGTGTATGTGAACTTGATATCATCTTTAATTTTGAGAAGGCCTATTTTATTTTGGATGAATTTCT CTTGGGAGGAGAAGTTCAGGAAACATCCAAGAAAAATGTCCTTAAAGCAATTGAGCAGGCCGATCTCCTG CAGGAGGAAGCTGAAACCCCACGTAGTGTTCTTGAAGAAATTGGACTGACATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001290378 |
Insert Size | 474 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001290378.1, NP_001277307.1 |
RefSeq Size | 2217 bp |
RefSeq ORF | 474 bp |
Locus ID | 108012 |
UniProt ID | Q9DB50 |
Cytogenetics | X F5 |
Gene Summary | Subunit of clathrin-associated adaptor protein complex 1 that plays a role in protein sorting in the late-Golgi/trans-Golgi network (TGN) and/or endosomes. The AP complexes mediate both the recruitment of clathrin to membranes and the recognition of sorting signals within the cytosolic tails of transmembrane cargo molecules (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an exon and contains an alternate 3' terminal exon, resulting in a different 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) is shorter than isoform 1 and has a distinct C-terminus. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228183 | Ap1s2 (myc-DDK-tagged) - Mouse adaptor-related protein complex 1, sigma 2 subunit (Ap1s2), transcript variant 2 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review