Thoc7 (NM_001285780) Mouse Untagged Clone

CAT#: MC225947

Thoc7 (untagged) - Mouse THO complex 7 homolog (Drosophila) (Thoc7), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Thoc7
• Synonyms: Nif3l1bp1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225947 representing NM_001285780
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGAGCACTCTGTCCCAGTGTGAATTTTCAATGGGCAAAACATTGCTGGTATATGATATGAATCTCA
  GAGAAATGGAAAATTATGAAAAAATATACAAAGAAATAGAATGTAGTATTGCTGGAGCACATGAAAAAAT
  TGCTGAGTGTAAAAAGCAGATTCTTCAAGCAAAACGAATACGAAAAAATCGACAAGAATATGACGCTTTG
  GCCAAAGTGATCCAGCATCACCCAGACAGGCATGAGACACTGAAGGAGCTAGAGGCTCTGGGCAAAGAAT
  TAGAGCATCTCTCACATATTAAAGAAAGTGTTGAAGATAAGCTGGAATTGAGACGGAAACAATTTCACGT
  TCTTCTTAGTACCATCCATGAACTTCAACAGACATTGGAGAATGATGACAAGCTGTCAGAGGTGGATGAA
  GCTCAAGAAAGCACCATGGAAGCAGACCCTAAGCCATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001285780
• Insert Size: 459 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001285780.1, NP_001272709.1
• RefSeq Size: 1069 bp
• RefSeq ORF: 459 bp
• Locus ID: 66231
• UniProt ID: Q7TMY4
• Cytogenetics: 14 A1
• Gene Summary: Required for efficient export of polyadenylated RNA. Acts as component of the THO subcomplex of the TREX complex which is thought to couple mRNA transcription, processing and nuclear export, and which specifically associates with spliced mRNA and not with unspliced pre-mRNA. TREX is recruited to spliced mRNAs by a transcription-independent mechanism, binds to mRNA upstream of the exon-junction complex (EJC) and is recruited in a splicing- and cap-dependent manner to a region near the 5' end of the mRNA where it functions in mRNA export to the cytoplasm via the TAP/NFX1 pathway.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.