Oard1 (NM_001289490) Mouse Untagged Clone
CAT#: MC225945
Oard1 (untagged) - Mouse O-acyl-ADP-ribose deacylase 1 (Oard1), transcript variant 1
"NM_001289490" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Oard1 |
Synonyms | AI314976; AW558560 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225945 representing NM_001289490
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCACCCGCCTTAATGAAGATCCAGAAGGAAGTCGAATCACTTACGTGAAAGGAGATCTTTTCGCAT GTCCCAAAACAGACTCTCTAGCCCATTGTATCAGTGAGGATTGTCGAATGGGTGCTGGAATAGCTGTTCT CTTCAAGAAGAGATTCGGAGGGGTGCAGGAACTGTTAAGTCAACAAAAGAAGTCTGGAGAAGTGGCTGTT CTGAAGAGAGATGGGCGATATATATATTACTTGATTACAAAGAAACGGGCTTCACACAAGCCAACGTATG AGAACCTACAGAAGAGTTTGGAGGCCATGAAGTCCCATTGTTTGAAGAATGGCGTCACTGACCTCTCCAT GCCCAGGATTGGATGTGGTCTGGATCGGCTGCAGTGGGAAAATGTATCTGCGATTCTCGAAGAGGTGTTT GAGTCAACAGACATCAAAATTACTGTGTACACACTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289490 |
Insert Size | 459 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289490.1, NP_001276419.1 |
RefSeq Size | 1354 bp |
RefSeq ORF | 459 bp |
Locus ID | 106821 |
UniProt ID | Q8R5F3 |
Cytogenetics | 17 C |
Gene Summary | ADP-ribose glycohydrolase that hydrolyzes ADP-ribose and acts on different substrates, such as proteins ADP-ribosylated on glutamate and O-acetyl-ADP-D-ribose. Specifically acts as a glutamate mono-ADP-ribosylhydrolase by mediating the removal of mono-ADP-ribose attached to glutamate residues on proteins. Does not act on poly-ADP-ribosylated proteins: the poly-ADP-ribose chain of poly-ADP-ribosylated glutamate residues must by hydrolyzed into mono-ADP-ribosylated glutamate by PARG to become a substrate for OARD1. Deacetylates O-acetyl-ADP ribose, a signaling molecule generated by the deacetylation of acetylated lysine residues in histones and other proteins. Catalyzes the deacylation of O-acetyl-ADP-ribose, O-propionyl-ADP-ribose and O-butyryl-ADP-ribose, yielding ADP-ribose plus acetate, propionate and butyrate, respectively.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 4. Variants 1-5 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228156 | Oard1 (myc-DDK-tagged) - Mouse O-acyl-ADP-ribose deacylase 1 (Oard1), transcript variant 1 |
USD 150.00 |
{0} Product Review(s)
Be the first one to submit a review