Mdk (NM_001291481) Mouse Untagged Clone

SKU
MC225869
Mdk (untagged) - Mouse midkine (Mdk), transcript variant 4
  $165.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mdk
Synonyms Mek; MK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC225869 representing NM_001291481
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCACCGAGGCTTCTTCCTTCTCGCCCTTCTTGCCCTCTTGGTGGTCACGTCCGCGGTGGCCAAAA
AAAAAGAGAAGGTGAAGAAGGGCAGCGAGTGTTCGGAGTGGACCTGGGGGCCCTGCACCCCCAGCAGCAA
GGACTGCGGCATGGGCTTCCGCGAGGGTACCTGTGGGGCCCAGACCCAGCGCGTCCATTGCAAGGTGCCC
TGCAACTGGAAGAAGGAATTTGGAGCCGACTGCAAATACAAGTTTGAGAGCTGGGGGGCGTGTGATGGGA
GCACTGGCACCAAAGCCCGCCAAGGGACCCTGAAGAAGGCGCGGTACAATGCCCAGTGCCAGGAGACCAT
CCGCGTGACTAAGCCCTGCACCTCCAAGACCAAGTCAAAGACCAAAGCCAAGAAAGGAAAAGGAAAGGAC
TAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001291481
Insert Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001291481.1, NP_001278410.1
RefSeq Size 785 bp
RefSeq ORF 423 bp
Locus ID 17242
UniProt ID P12025
Cytogenetics 2 50.63 cM
Summary This gene encodes a secreted growth factor that belongs to the pleiotrophin/midkine heparin-binding protein family and functions in a variety of biological processes. The encoded cytokine promotes the growth, differentiation, survival and migration of several target cells including leucocytes involved in inflammation. This protein plays a role in the formation of scar tissue and intraperitoneal adhesions, and promotes neurite outgrowth and neuron survival. The protein encoded by this gene is associated with obesity and inhibition of insulin signaling in fat cells. A pseudogene of this gene is present on chromosome 11. Alternative splicing results in multiple transcript variants. provided by RefSeq, Apr 2014
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1 through 4 encode the same isoform (a).
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001291481" in other vectors (1)
SKU Description Size Price
MR228080 Mdk (myc-DDK-tagged) - Mouse midkine (Mdk), transcript variant 4 10 ug
$289.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.