Mllt3 (NM_001286158) Mouse Untagged Clone

CAT#: MC225855

Mllt3 (untagged) - Mouse myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 3 (Mllt3), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mllt3
• Synonyms: 2210011H10Rik; 2610012I03Rik; 3830408D16Rik; Af9; D4Ertd321e
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225855 representing NM_001286158
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAAGATCTGCATTCTGATGACAACGAGGAGGAGTCTGATGAGGCAGAGGACAATGACAATGACTCGG
  AGATGGAAAGACCTGTAAATAGAGGAGGAAGCCGAAGTCGCAGGGTCAGCTTGAGTGACGGCAGTGACAG
  TGAAAGCAGCTCCGCCTCTTCCCCTCTCCATCATGAACCCCCGCCACCATTATTGAAAACTAACAACAAC
  CAGATCCTTGAAGTGAAAAGTCCAATAAAACAAAGCAAATCAGATAAGCAAATAAAGAATGGTGAATGTG
  ACAAGATCGTGAACCTTATAGAGGAAACTGGACACTTTCATATTACGAATACAACATTTGATTTTGATCT
  TTGCTCGCTGGACAAAACTACAGTCCGTAAATTACAGAGTTACCTGGAAACATCTGGAACATCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286158
• Insert Size: 417 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286158.1, NP_001273087.1
• RefSeq Size: 4730 bp
• RefSeq ORF: 417 bp
• Locus ID: 70122
• Cytogenetics: 4 41.06 cM
• Gene Summary: Chromatin reader component of the super elongation complex (SEC), a complex required to increase the catalytic rate of RNA polymerase II transcription by suppressing transient pausing by the polymerase at multiple sites along the DNA. Specifically recognizes and binds acylated histone H3, with a marked preference for histone H3 that is crotonylated. Crotonylation marks active promoters and enhancers and confers resistance to transcriptional repressors. Recognizes and binds histone H3 crotonylated at 'Lys-9' (H3K9cr), and with slightly lower affinity histone H3 crotonylated at 'Lys-18' (H3K18cr). Also recognizes and binds histone H3 acetylated at 'Lys-9' (H3K9ac), but with lower affinity than crotonylated histone H3. In the SEC complex, MLLT3 is required to recruit the complex to crotonylated histones.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) uses an alternate 5' exon structure, initiates translation at a downstream start codon and lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. It encodes isoform 3, which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.