Anp32e (NM_001253758) Mouse Untagged Clone

CAT#: MC225852

Anp32e (untagged) - Mouse acidic (leucine-rich) nuclear phosphoprotein 32 family, member E (Anp32e), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Anp32e
• Synonyms: 2810018A15Rik; AI047746; AI326868; CPD1; LANP-L; LANPL; mLANP-L
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225852 representing NM_001253758
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGATGAAGAAGAAGATTAACATGGAGTTGAAGAACAGAGCCCCGGAGGAGATCACCTACCTGGACG
  GATTCGACCAGGAGGACAACGAAGCTCCCGACTCGGAGGAGGAGGATGACGACGACGAGGATGGAGATGA
  AGATGAGGAAGATGAGGACGAAGATGAAGCTGGCCCACCGGAAGGCTATGAAGAGGAGGAAGATGACGAT
  GAGGATGAAGCTGGCTCAGAAGTGGGAGAGGGAGAAGAGGAGGTGGGCCTCTCATACTTAATGAAAGACG
  AAATTCAGGATGAAGAGGACGATGATGACTACGTTGATGAAGGGGAGGAGGAGGAAGAAGAGGAGGAAGA
  GGGTCTTCGGGGAGAGAAGAGAAAGCGAGATGCTGAGGATGACGGGGAGGAAGACGACGATTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001253758
• Insert Size: 414 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001253758.1, NP_001240687.1
• RefSeq Size: 2904 bp
• RefSeq ORF: 414 bp
• Locus ID: 66471
• UniProt ID: P97822
• Cytogenetics: 3 F2.1
• Gene Summary: Histone chaperone that specifically mediates the genome-wide removal of histone H2A.Z/H2AFZ from the nucleosome: removes H2A.Z/H2AFZ from its normal sites of deposition, especially from enhancer and insulator regions. Not involved in deposition of H2A.Z/H2AFZ in the nucleosome. May stabilize the evicted H2A.Z/H2AFZ-H2B dimer, thus shifting the equilibrium towards dissociation and the off-chromatin state (PubMed:24463511). Inhibits activity of protein phosphatase 2A (PP2A). Does not inhibit protein phosphatase 1. May play a role in cerebellar development and synaptogenesis.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (3) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.