Anapc15 (NM_001291353) Mouse Untagged Clone
CAT#: MC225817
Anapc15 (untagged) - Mouse anaphase prompoting complex C subunit 15 (Anapc15), transcript variant 5
"NM_001291353" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Anapc15 |
Synonyms | 3200002M19Rik; 6330414C15Rik; APC15 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225817 representing NM_001291353
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCCAGGACTCAAACTCAGCTTAGGAGCCATGTCCACCTTGTTCCCGTCACTCTTCCCTCGTGTGA CTGAGACACTGTGGTTTAATCTGGACCGACCCTGTGTGGAGGAGACAGAGCTGCAGCAGCAGGAGCAGCA GCATCAGGCCTGGCTCCAAAGCATCGCAGAGAAAGACAACAACCTGGTACCAATTGGCAAGCCGGCCTCA GAGCACTACGATGATGAGGAAGAAGAGGATGATGAAGATGATGAGGACAGTGAAGAGGATTCCGAAGATG ATGAGGACATGCAAGACATGGATGAGATGAATGACTATAATGAGTCACCTGATGATGGAGAGGTCAATGA GGTGGACATGGAAGGCAACGAACAGGATCAGGACCAGTGGATGATCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291353 |
Insert Size | 399 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291353.1, NP_001278282.1 |
RefSeq Size | 843 bp |
RefSeq ORF | 399 bp |
Locus ID | 75430 |
UniProt ID | P60007 |
Cytogenetics | 7 E2 |
Gene Summary | Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. In the complex, plays a role in the release of the mitotic checkpoint complex (MCC) from the APC/C: not required for APC/C activity itself, but promotes the turnover of CDC20 and MCC on the APC/C, thereby participating in the responsiveness of the spindle assembly checkpoint. Also required for degradation of CDC20 (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5) differs in the 5' UTR and uses an alternate splice junction at the 3' end of one exon and at the 5' end of the next exon compared to variant 1. The resulting isoform (c) has a shorter and distinct N-terminus compared to isoform a. Variants 3, 4, and 5 all encode the same isoform (c). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228028 | Anapc15 (myc-DDK-tagged) - Mouse anaphase prompoting complex C subunit 15 (Anapc15), transcript variant 5 |
USD 150.00 |
{0} Product Review(s)
Be the first one to submit a review