Anapc15 (NM_001291352) Mouse Untagged Clone

CAT#: MC225816

Anapc15 (untagged) - Mouse anaphase prompoting complex C subunit 15 (Anapc15), transcript variant 4

USD 196.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Anapc15 (NM_001291352) Mouse Untagged Clone
Symbol Anapc15
Synonyms 3200002M19Rik; 6330414C15Rik; APC15
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC225816 representing NM_001291352
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCCAGGACTCAAACTCAGCTTAGGAGCCATGTCCACCTTGTTCCCGTCACTCTTCCCTCGTGTGA
CTGAGACACTGTGGTTTAATCTGGACCGACCCTGTGTGGAGGAGACAGAGCTGCAGCAGCAGGAGCAGCA
GCATCAGGCCTGGCTCCAAAGCATCGCAGAGAAAGACAACAACCTGGTACCAATTGGCAAGCCGGCCTCA
GAGCACTACGATGATGAGGAAGAAGAGGATGATGAAGATGATGAGGACAGTGAAGAGGATTCCGAAGATG
ATGAGGACATGCAAGACATGGATGAGATGAATGACTATAATGAGTCACCTGATGATGGAGAGGTCAATGA
GGTGGACATGGAAGGCAACGAACAGGATCAGGACCAGTGGATGATCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001291352
ORF Size 399 bp
Insert Size 399
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001291352.1, NP_001278281
RefSeq Size 843
RefSeq ORF 399
Locus ID 75430
Cytogenetics 7|7 E2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.