Oaz1 (NM_001301034) Mouse Untagged Clone

CAT#: MC225809

Oaz1 (untagged) - Mouse ornithine decarboxylase antizyme 1 (Oaz1), transcript variant 2

  View "NM_001301034" in other vectors (1)

USD 200.00


Availability*
2 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Oaz1 (NM_001301034) Mouse Untagged Clone
Symbol Oaz1
Synonyms Antizyme; AZ-1; AZ1; Oaz; ODC-Az
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC225809 representing NM_001301034
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGAAATCCTCCCTGCAGCGGATCCTCAACAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGACAAAC
GCAGCGCCACGCTTCACGCCAGCCGCACCATGCCGCTTCTTAGTCAGCACAGCCGCGGCGGCTGCAGCAG
CGAGAGGGTTGCCCTTAATTGCTGTAGTAACCTGGGTCCGGGGCCTCGGTGGTGCTCCATGGTGAAATCC
TCCCTGCAGCGGATCCTCAACAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGACAAACGCAGCGCCACGC
TTCACGCCAGCCGCACCATGCCGCTTCTTAGTCAGCACAGCCGCGGCGGCTGCAGCAGCGAGAGGGTTGC
CCTTAATTGCTGTAGTAACCTGGGTCCGGGGCCTCGGTGGTGCTCC


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001301034
ORF Size 396 bp
Insert Size 396
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001301034.1, NP_001287963
RefSeq Size 1086
RefSeq ORF 396
Locus ID 18245
Cytogenetics 10 C1|10 39.72 cM
Gene Summary The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 1, the first member of the antizyme family, that has broad tissue distribution, and negatively regulates intracellular polyamine levels by binding to and targeting ODC for degradation, as well as inhibiting polyamine uptake. Antizyme 1 mRNA contains two potential in-frame AUGs; and studies in rat suggest that alternative use of the two translation initiation sites results in N-terminally distinct protein isoforms with different subcellular localization. Alternatively spliced transcript variants have also been noted for this gene. [provided by RefSeq, Dec 2014]

Other Versions

Other products for "Oaz1"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones