Oaz1 (NM_001301034) Mouse Untagged Clone
CAT#: MC225809
Oaz1 (untagged) - Mouse ornithine decarboxylase antizyme 1 (Oaz1), transcript variant 2
Product images

Specifications
Product Data | |
Product Name | Oaz1 (NM_001301034) Mouse Untagged Clone |
Symbol | Oaz1 |
Synonyms | Antizyme; AZ-1; AZ1; Oaz; ODC-Az |
Vector | pCMV6-Entry |
Sequence Data |
>MC225809 representing NM_001301034
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGAAATCCTCCCTGCAGCGGATCCTCAACAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGACAAAC GCAGCGCCACGCTTCACGCCAGCCGCACCATGCCGCTTCTTAGTCAGCACAGCCGCGGCGGCTGCAGCAG CGAGAGGGTTGCCCTTAATTGCTGTAGTAACCTGGGTCCGGGGCCTCGGTGGTGCTCCATGGTGAAATCC TCCCTGCAGCGGATCCTCAACAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGACAAACGCAGCGCCACGC TTCACGCCAGCCGCACCATGCCGCTTCTTAGTCAGCACAGCCGCGGCGGCTGCAGCAGCGAGAGGGTTGC CCTTAATTGCTGTAGTAACCTGGGTCCGGGGCCTCGGTGGTGCTCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
Tag | Tag Free |
ACCN | NM_001301034 |
ORF Size | 396 bp |
Insert Size | 396 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This clone expresses the complete ORF with c-terminal tags of Myc-DDK |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reference Data | |
RefSeq | NM_001301034.1, NP_001287963 |
RefSeq Size | 1086 |
RefSeq ORF | 396 |
Locus ID | 18245 |
Cytogenetics | 10 C1|10 39.72 cM |
Gene Summary | The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 1, the first member of the antizyme family, that has broad tissue distribution, and negatively regulates intracellular polyamine levels by binding to and targeting ODC for degradation, as well as inhibiting polyamine uptake. Antizyme 1 mRNA contains two potential in-frame AUGs; and studies in rat suggest that alternative use of the two translation initiation sites results in N-terminally distinct protein isoforms with different subcellular localization. Alternatively spliced transcript variants have also been noted for this gene. [provided by RefSeq, Dec 2014]. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
cDNA Clone Resources |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228020 | Oaz1 (myc-DDK-tagged) - Mouse ornithine decarboxylase antizyme 1 (Oaz1), transcript variant 2 |
USD 380.00 |
Other products for "Oaz1"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.