Agbl3 (NM_001289658) Mouse Untagged Clone
CAT#: MC225799
Agbl3 (untagged) - Mouse ATP/GTP binding protein-like 3 (Agbl3), transcript variant 4
"NM_001289658" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Agbl3 |
Synonyms | 2900053G10Rik; 4930431N21Rik; 6530406M24Rik; CCP3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225799 representing NM_001289658
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCAGAAGATTCAGAGGAGGAAGACTACTCAGATAGAAGCATCAGTGATGACGATGACTTGGATGAGG ATTCCTTCATGAAATTTGTAAGTGATGATATTCATCCGTGCACACTACTGGCAGCTGATTCTATTGGTGA CCCATTCTTCCCTCGGACTACACAAATTTTATTGGAGTATCAGCTAGGAAGATGGGTACCACGCCTTCGC GGACCACGAGATTTATATGGTGTCTCTTCTTCTGGTCCACTGAGCCCAACACGGTGGCCATACCACTGTG AGGTCATTGATGAAAAAGTCCAGCATATTGGTATGTTTTTAGAAGTTTTGGGGATTCAGACATTAGCAAA CTTATCAATCTTGATGTTAATGAGGACACTAATGATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289658 |
Insert Size | 390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289658.1, NP_001276587.1 |
RefSeq Size | 1328 bp |
RefSeq ORF | 390 bp |
Locus ID | 76223 |
UniProt ID | Q8CDP0 |
Cytogenetics | 6 B1 |
Gene Summary | Metallocarboxypeptidase that mediates both deglutamylation and deaspartylation of target proteins. Catalyzes the deglutamylation of polyglutamate side chains generated by post-translational polyglutamylation in proteins such as tubulins. Also removes gene-encoded polyglutamates or polyaspartates from the carboxy-terminus of target proteins such as MYLK. Does not show detyrosinase or deglycylase activities from the carboxy-terminus of tubulin.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) lacks multiple 3' coding exons and its transcription extends past a splice site used in variant 1, resulting in a different 3' coding region and 3' UTR. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228010 | Agbl3 (myc-DDK-tagged) - Mouse ATP/GTP binding protein-like 3 (Agbl3), transcript variant 4 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review