Il15ra (NM_001271497) Mouse Untagged Clone

SKU
MC225762
Il15ra (untagged) - Mouse interleukin 15 receptor, alpha chain (Il15ra), transcript variant 3
  $165.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Il15ra
Synonyms AA690181; IL-15RA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC225762 representing NM_001271497
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCACAGAGACAGCTATTATGCCTGGCTCCAGGCTGACACCATCCCAAACAACTTCTGCAGGAACTA
CAGGGACAGGCAGTCACAAGTCCTCCCGAGCCCCATCTCTTGCAGCAACAATGACCTTGGAGCCTACAGC
CTCCACCTCCCTCAGGATAACAGAGATTTCTCCCCACAGTTCCAAAATGACGAAAGTGGCCATCTCTACA
TCGGTCCTCTTGGTTGGTGCAGGGGTTGTGATGGCTTTCCTGGCCTGGTACATCAAATCAAGGCAGCCTT
CTCAGCCGTGCCGTGTTGAGGTGGAAACCATGGAAACAGTACCAATGACTGTGAGGGCCAGCAGCAAGGA
GGATGAAGACACAGGAGCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001271497
Insert Size 372 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001271497.1, NP_001258426.1
RefSeq Size 1601 bp
RefSeq ORF 372 bp
Locus ID 16169
UniProt ID Q60819
Cytogenetics 2 8.97 cM
Summary High-affinity receptor for interleukin-15 (PubMed:17947230). Can signal both in cis and trans where IL15R from one subset of cells presents IL15 to neighboring IL2RG-expressing cells (PubMed:17947230). In neutrophils, binds and activates kinase SYK in response to IL15 stimulation (By similarity). In neutrophils, required for IL15-induced phagocytosis in a SYK-dependent manner (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (3) contains an alternate 5'-most exon and uses an alternate donor splice site in another exon in the 5' UTR compared to variant 1. These differences cause translation initiation at a downstream AUG and results in an isoform (2) with a shorter N-terminus, compared to isoform 1. Both variants 2 and 3 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001271497" in other vectors (1)
SKU Description Size Price
MR227973 Il15ra (myc-DDK-tagged) - Mouse interleukin 15 receptor, alpha chain (Il15ra), transcript variant 3 10 ug
$289.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.