Glrx2 (NM_001038594) Mouse Untagged Clone

SKU
MC225757
Glrx2 (untagged) - Mouse glutaredoxin 2 (thioltransferase) (Glrx2), transcript variant 4
  $165.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Glrx2
Synonyms 1700010P22Rik; AI645710; Grx2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC225757 representing NM_001038594
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAAACAGCACATCGTCGTTTTGGGGGAAGTCTACAACTACTCCTGTGAACCAGATCCAAGAAACAA
TTTCTAACAATTGTGTGGTGATCTTCTCAAAAACATCCTGCTCTTACTGTTCCATGGCCAAGAAGATTTT
CCATGACATGAATGTCAACTACAAGGCTGTGGAGTTGGATATGCTGGAATATGGCAACCAGTTTCAAGAT
GCGCTTCACAAGATGACTGGGGAAAGAACCGTTCCCAGGATATTTGTCAATGGACGATTTATTGGAGGCG
CAGCGGACACTCACAGGCTTCACAAAGAAGGGAAATTGCTGCCTCTGGTTCATCAGTGTTATTTAAAAAA
AAAACAAGAGGAAAGACATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001038594
Insert Size 372 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001038594.1, NP_001033683.1
RefSeq Size 3445 bp
RefSeq ORF 372 bp
Locus ID 69367
UniProt ID Q923X4
Cytogenetics 1 62.53 cM
Summary Glutathione-dependent oxidoreductase that facilitates the maintenance of mitochondrial redox homeostasis upon induction of apoptosis by oxidative stress. Involved in response to hydrogen peroxide and regulation of apoptosis caused by oxidative stress. Acts as a very efficient catalyst of monothiol reactions because of its high affinity for protein glutathione-mixed disulfides. Can receive electrons not only from glutathione (GSH), but also from thioredoxin reductase supporting both monothiol and dithiol reactions. Efficiently catalyzes both glutathionylation and deglutathionylation of mitochondrial complex I, which in turn regulates the superoxide production by the complex. Overexpression decreases the susceptibility to apoptosis and prevents loss of cardiolipin and cytochrome c release.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001038594" in other vectors (1)
SKU Description Size Price
MR227968 Glrx2 (myc-DDK-tagged) - Mouse glutaredoxin 2 (thioltransferase) (Glrx2), transcript variant 4 10 ug
$289.00

Welcome to OriGene AI!

I'm your AI-powered guide to everything OriGene.
Ask me anything:

  • Product specs
  • Ordering help
  • Technical questions
  • How to find exactly what your experiment needs

Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.

Velaro Chat Img

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.