Fgf5 (NM_001277268) Mouse Untagged Clone
CAT#: MC225747
Fgf5 (untagged) - Mouse fibroblast growth factor 5 (Fgf5), transcript variant 2
"NM_001277268" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fgf5 |
Synonyms | angora; Fgf-5; Fgf3a; go; HBGF-5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225747 representing NM_001277268
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCCTGTCCTTGCTCTTCCTCATCTTCTGCAGCCACCTGATCCACAGCGCTTGGGCTCACGGGGAGA AGCGTCTCACTCCCGAAGGGCAACCCGCGCCTCCTAGGAACCCGGGAGACTCCAGCGGCAGCCGGGGCAG AAGTAGCGCGACGTTTTCTTCGTCTTCTGCCTCCTCACCAGTCGCAGCTTCTCCGGGCAGCCAAGGAAGC GGCTCGGAACATAGCAGTTTCCAGTGGAGCCCTTCGGGGCGCCGGACCGGCAGCCTGTACTGCAGAGTGG GCATCGGTTTCCATCTGCAGATCTACCCGGATGGCAAAGTCAATGGCTCCCACGAAGCCAGTGTGTTAAG CCAAATTTACGGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001277268 |
Insert Size | 366 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001277268.1, NP_001264197.1 |
RefSeq Size | 2449 bp |
RefSeq ORF | 366 bp |
Locus ID | 14176 |
UniProt ID | P15656 |
Cytogenetics | 5 47.77 cM |
Gene Summary | This gene encodes a secreted protein that is a member of a family of heparin-binding growth factors. The encoded protein regulates cell proliferation, particularly the growth of hair follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013] Transcript Variant: This variant (2, also known as FGF-5S) lacks an alternate exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227958 | Fgf5 (myc-DDK-tagged) - Mouse fibroblast growth factor 5 (Fgf5), transcript variant 2 |
USD 150.00 |
{0} Product Review(s)
Be the first one to submit a review