Cnih2 (NM_001302333) Mouse Untagged Clone
CAT#: MC225710
Cnih2 (untagged) - Mouse cornichon homolog 2 (Drosophila) (Cnih2), transcript variant 2
"NM_001302333" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cnih2 |
Synonyms | C; CNIH-2; Cnil |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225710 representing NM_001302333
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGCTGTGCTGAGCGCGAGCGTTTGAAAAACATCGAACGCATCTGCTGCCTCCTGAGGAAGCTGGTGG TCCCGGAATATTCCATCCACGGCCTCTTCTGTCTGATGTTTCTGTGTGCAGCAGAGTGGGTGACCCTGGG CCTCAACATCCCCCTCCTCTTCTACCACCTCTGGAGGTACTTCCACCGTCCTGCGGATGGCTCTGAGGTC ATGTATGATGCGGTCTCTATCATGAATGCTGACATCCTCAACTACTGCCAGAAGGAGTCCTGGTGCAAAC TCGCCTTCTACCTGCTGTCCTTCTTCTATTACCTGTACAGTATGGTTTATACGTTGGTGAGCTTCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302333 |
Insert Size | 348 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001302333.1, NP_001289262.1 |
RefSeq Size | 1387 bp |
RefSeq ORF | 348 bp |
Locus ID | 12794 |
Cytogenetics | 19 A |
Gene Summary | This gene encodes a protein that is an auxiliary subunit of the ionotropic glutamate receptor of the AMPA subtype. This protein is similar to a Drosophila protein involved in anterior-posterior and dorsal-ventral patterning. Cnih2 conditional knockout mice exhibit reduced AMPA receptor synaptic transmission in the hippocampus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227921 | Cnih2 (myc-DDK-tagged) - Mouse cornichon homolog 2 (Drosophila) (Cnih2), transcript variant 2 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review