Fgf12 (NM_001276420) Mouse Untagged Clone
CAT#: MC225709
Fgf12 (untagged) - Mouse fibroblast growth factor 12 (Fgf12), transcript variant 4
"NM_001276420" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fgf12 |
Synonyms | AV114868; B230343J05Rik; FGF-12; FHF-1; Fhf1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225709 representing NM_001276420
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAGTCCAACAGCGACCGGG TGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGACGGGCGCTCCCTGTGTGAGAGGCACGTCCTCGG GGTGTTCAGCAAAGTGCGCTTCTGCAGCGGCCGCAAGAGGCCAGTGAGGCGGAGACCAGAACCCCAGCTG AAAGGGATTGTGACAAGGTTATTCAGCCAGCAGGGATATTTCCTGCAGATGCATCCAGATGGTACCATTG ATGGGACCAAGGACGAAAACAGCGACTACAGTAAGGAACGCCAGCTACTTGCAATGCAGTGCAAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001276420 |
Insert Size | 348 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001276420.1, NP_001263349.1 |
RefSeq Size | 2545 bp |
RefSeq ORF | 348 bp |
Locus ID | 14167 |
Cytogenetics | 16 19.38 cM |
Gene Summary | Involved in nervous system development and function. Promote neuronal excitability by elevating the voltage dependence of neuronal sodium channel SCN8A fast inactivation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) uses an alternate 3' exon structure and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform d which is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227920 | Fgf12 (myc-DDK-tagged) - Mouse fibroblast growth factor 12 (Fgf12), transcript variant 4 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review