Atp5j (NM_001302213) Mouse Untagged Clone

SKU
MC225670
Atp5j (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F (Atp5j), transcript variant 1
  $165.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Atp5j
Synonyms Atp5pf; CF6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC225670 representing NM_001302213
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTTCTGCAGAGGATCTTCAGGCTCTCCTCTGTCCTTCGGTCAGCAGTCTCTGTGCATTTGAAGAGGA
ACATTGGTGTTACAGCTGTGGCCTTTAATAAGGAACTTGATCCTGTACAGAAACTCTTCGTGGACAAGAT
AAGAGAGTACAAATCAAAGCGACAGGCATCTGGAGGACCTGTTGATATTGGCCCAGAGTATCAGCAAGAT
CTGGACAGAGAGCTTTATAAGCTTAAACAAATGTATGGTAAAGGAGAGATGGATACATTTCCTACCTTCA
AATTTGATGATCCCAAATTTGAAGTCATCGACAAACCCCAGTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001302213
Insert Size 327 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001302213.1, NP_001289142.1
RefSeq Size 875 bp
RefSeq ORF 327 bp
Locus ID 11957
UniProt ID P97450
Cytogenetics 16 C3.3
Summary The protein encoded by this gene is a component of mitochondrial adenosine triphosphate synthase, which catalyzes the conversion of ATP from ADP. Mitochondrial adenosine triphosphate synthase consists of extrinsic and intrinsic membrane domains that are joined by a stalk. The protein encoded by this gene is a subunit of the stalk domain. A bi-directional promoter that drives expression of this gene has been has been identified. Pseudogenes of this gene are found on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. provided by RefSeq, Oct 2014
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, 3, 4, 5, 6 and 7 encode the same protein.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001302213" in other vectors (1)
SKU Description Size Price
MR227881 Atp5j (myc-DDK-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F (Atp5j), transcript variant 1 10 ug
$289.00

Welcome to OriGene AI!

I'm your AI-powered guide to everything OriGene.
Ask me anything:

  • Product specs
  • Ordering help
  • Technical questions
  • How to find exactly what your experiment needs

Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.

Velaro Chat Img

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.