H2al1i (NM_001242954) Mouse Untagged Clone
CAT#: MC225651
Gm14475 (untagged) - Mouse predicted gene 14475 (Gm14475)
"NM_001242954" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | H2al1i |
Synonyms | ENSMUSG00000073279; Gm14475; OTTMUSG00000016780 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225651 representing NM_001242954
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAAGAAAATGCAAAGGCGAAGAAGACAGAAAAGAACCCGCTCCCAGAGAGGTGAGCTTCCTTTCA GCCTTGTAGATCGTTTCCTACGAGAGGAATTCCATTCCAGTCGCCTGAGCTCTTCCGCACTTTCATTCCT CACGAGTGTGCTCGAGTACTTAACATCGAACATCCTCGAACTGGCTGGTGAGGTGGCCCAGACCACTGGC AGGAAGCGCATAGCTCCAGAGGATGTACGTCTGGTGGTACAGAACAACGAACAGCTCCGCCAACTCTTCA AACCAGGTGGCACATCAGTGAATGAGGATGACAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242954 |
Insert Size | 318 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001242954.1, NP_001229883.1 |
RefSeq Size | 318 bp |
RefSeq ORF | 318 bp |
Locus ID | 100042946 |
UniProt ID | Q5M8Q2 |
Cytogenetics | X |
Gene Summary | Atypical histone H2A which can replace conventional H2A in some nucleosomes and may play a role during spermatogenesis. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227862 | Gm14475 (myc-DDK-tagged) - Mouse predicted gene 14475 (Gm14475) |
USD 150.00 |
{0} Product Review(s)
Be the first one to submit a review