Fmn1 (NM_001287818) Mouse Untagged Clone
CAT#: MC225642
Fmn1 (untagged) - Mouse formin 1 (Fmn1), transcript variant 6
"NM_001287818" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fmn1 |
Synonyms | Fmn; formin-1; ld |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225642 representing NM_001287818
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAAGAAAGTCACTTGGAGAATGCACAGAAAAGTTTTGAAACAACAGTGGGATATTTTGGAATGAAGC CAAAGACTGGAGAGAAGGAGGTCACCCCCAGCTATGTGTTTATGGTGTGGTTTGAGTTCTGCAGTGACTT CAAGACCATTTGGAAGCGGGAGAGTAAGAACATATCTAAAGAAAGATTGAAAATGGCTCAGGCATCCGTC AGCAAACTGACATCAGAGAAGAAAGTGGAGACAAAGAAAATCAATCCCACCGCTAGTCTGAAAGAAAGAC TGCGTCAGAAGGAAGCCAGCGTGGCCACCAACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287818 |
Insert Size | 315 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001287818.1, NP_001274747.1 |
RefSeq Size | 7767 bp |
RefSeq ORF | 315 bp |
Locus ID | 14260 |
Cytogenetics | 2 57.3 cM |
Gene Summary | Plays a role in the formation of adherens junction and the polymerization of linear actin cables.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6) represents the use of an alternate promoter, differs in the 5' UTR, lacks a significant portion of the 5' coding sequence and uses a downstream start codon compared to variant 1. The resulting protein (isoform 5) has a shorter N-terminus compared to isoform 1. Variants 5 and 6 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227853 | Fmn1 (myc-DDK-tagged) - Mouse formin 1 (Fmn1), transcript variant 6 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review