Dda1 (NM_001294258) Mouse Untagged Clone
CAT#: MC225624
Dda1 (untagged) - Mouse DET1 and DDB1 associated 1 (Dda1), transcript variant 2
"NM_001294258" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Dda1 |
Synonyms | 1500034J01Rik; 1700095J19Rik; R74921 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225624 representing NM_001294258
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGACTTTCTGAAAGGCTTGCCCGTCTACAACAAGAGCAACTTCAGCAGGTTCCACGCGGACTCTG TGTGCAAGGCCTCGAACCGCCGTCCCTCAGTATACCTGCCGACCCGAGAGTACCCGTCAGAACAGAAATG CTGCCAAGAAGAGAGACCAAGAGCAGGTGGAGGCGGAGGGCGAGAGCTCAGCGCCACCTCGCAAGGTGGC CCGGACCGACAGCCCCGACATGCCGGAGGACACCTAGGTCCTGTGCATCTCCCCTCATCTGTCAGCTCTG TCCACTCCCACCCGCGTGTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001294258 |
Insert Size | 303 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001294258.1, NP_001281187.1 |
RefSeq Size | 1875 bp |
RefSeq ORF | 303 bp |
Locus ID | 66498 |
UniProt ID | Q9D9Z5 |
Cytogenetics | 8 B3.3 |
Gene Summary | May be involved in ubiquitination and subsequent proteasomal degradation of target proteins. Component of the DDD-E2 complexes which may provide a platform for interaction with CUL4A and WD repeat proteins (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227835 | Dda1 (myc-DDK-tagged) - Mouse DET1 and DDB1 associated 1 (Dda1), transcript variant 2 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review