Pym1 (NM_001253705) Mouse Untagged Clone

CAT#: MC225592

Wibg (untagged) - Mouse within bgcn homolog (Drosophila) (Wibg), transcript variant 4


  "NM_001253705" in other vectors (1)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Pym1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pym1
Synonyms A030010B05Rik; Pym; Wibg
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225592 representing NM_001253705
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAACCGCCAGCACCCCCGAGGCCACGGGGACAGGCAAGTACATTGCCTCAACACAGAGACCCGACG
GGACGTGGCGAAAGCAGCGGAGGGTCAAAGAAGGATACGTGCCCCAAGAGGAGGTCCCAGTGTGCGTGGT
TAGGCTTAACAAGGGGTTTTTAATGGGTTCCTACACAAGTATAGCATATTATGCCGTGGAGTTCAGGGAT
GAATCGTCTGGGCCCGAAAGAAATGGAAGGAGGGACAACGGTCTCGGGAGAGGAAGGAGCTGGGCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001253705
Insert Size 279 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001253705.1, NP_001240634.1
RefSeq Size 1324 bp
RefSeq ORF 279 bp
Locus ID 78428
Cytogenetics 10 D3
Gene Summary Key regulator of the exon junction complex (EJC), a multiprotein complex that associates immediately upstream of the exon-exon junction on mRNAs and serves as a positional landmark for the intron exon structure of genes and directs post-transcriptional processes in the cytoplasm such as mRNA export, nonsense-mediated mRNA decay (NMD) or translation. Acts as an EJC disassembly factor, allowing translation-dependent EJC removal and recycling by disrupting mature EJC from spliced mRNAs. Its association with the 40S ribosomal subunit probably prevents a translation-independent disassembly of the EJC from spliced mRNAs, by restricting its activity to mRNAs that have been translated. Interferes with NMD and enhances translation of spliced mRNAs, probably by antagonizing EJC functions (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) uses an alternate splice site that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (4) has a distinct and shorter C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.