Smpx (NM_001252591) Mouse Untagged Clone
CAT#: MC225556
Smpx (untagged) - Mouse small muscle protein, X-linked (Smpx), transcript variant 2
"NM_001252591" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Smpx |
Synonyms | 1010001C09Rik; Csl |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225556 representing NM_001252591
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGAAGCAGCCAATTTCCAACGTCAGAGCCATCCAGGCGAATATCAATATTCCAATGGGAGCCTTTC GTCCGGGAGCTGGGCAGCCTCCCAGAAGGAAAGAGAGTACTCCTGAAACTGAGGAGGGAGCTCCTACCAC CTCAGAGGAAAAGAAGCCAATTCCTGGAATGAAGAAATTTCCAGGACCTGTTGTCAACTTGTCTGAGATC CAAAATGTTAAAAGTGAACTGAAATTTGTCCCCAAAGGTGAACAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252591 |
Insert Size | 258 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001252591.2, NP_001239520.1 |
RefSeq Size | 1070 bp |
RefSeq ORF | 258 bp |
Locus ID | 66106 |
UniProt ID | Q9DC77 |
Cytogenetics | X F4 |
Gene Summary | Plays a role in the regulatory network through which muscle cells coordinate their structural and functional states during growth, adaptation, and repair.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227767 | Smpx (myc-DDK-tagged) - Mouse small muscle protein, X-linked (Smpx), transcript variant 2 |
USD 150.00 |
{0} Product Review(s)
Be the first one to submit a review