Gng4 (NM_001302997) Mouse Untagged Clone

CAT#: MC225517

Gng4 (untagged) - Mouse guanine nucleotide binding protein (G protein), gamma 4 (Gng4), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gng4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225517 representing NM_001302997
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGGAAGGCATGTCTAATAACAGCACCACCAGCATCTCCCAGGCCAGGAAAGCCGTGGAGCAGCTGA
  AGATGGAAGCCTGCATGGACAGGGTGAAGGTCTCCCAGGCTGCCTCAGACCTCCTGGCCTACTGTGAAGC
  CCACGTGCGGGAGGACCCCCTCATCATCCCAGTGCCTGCCTCAGAAAACCCCTTCCGGGAGAAGAAGTTC
  TTCTGCACCATCCTCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302997
• Insert Size: 228 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302997.1, NP_001289926.1
• RefSeq Size: 2912 bp
• RefSeq ORF: 228 bp
• Locus ID: 14706
• UniProt ID: P50153
• Cytogenetics: 13 5.29 cM
• Gene Summary: This gene encodes the gamma subunit of the heterotrimeric G-proteins that are comprised of alpha, beta and gamma subunits. Upon activation by G protein-coupled receptors, the beta-gamma heterodimer dissociates from the alpha subunit to activate downstream signaling events. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.