Jagn1 (NM_001243739) Mouse Untagged Clone

CAT#: MC225499

Jagn1 (untagged) - Mouse jagunal homolog 1 (Drosophila) (Jagn1), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Jagn1
• Synonyms: 5830427H10Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225499 representing NM_001243739
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGTCTCGGGCAGGCCCGCGAGCGGCCGGCACCGACGGCAGCGACTTTCAGCACCGGGAGCGCGTCG
  CCATGCACTACCAGATGAGGTACGAGTGTGACCCTCAAGTACGAAATCAAGAAGCTGATCTACGTGCATC
  TCGTCATATGGCTGCTGTTGGTGGCCAAGATGAGCGTGGGACACCTGAGGCTCTTGTCACATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243739
• Insert Size: 204 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243739.1, NP_001230668.1
• RefSeq Size: 1225 bp
• RefSeq ORF: 204 bp
• Locus ID: 67767
• UniProt ID: Q5XKN4
• Cytogenetics: 6 E3
• Gene Summary: Endoplasmic reticulum transmembrane protein involved in vesicle-mediated transport, which is required for neutrophil function. Required for vesicle-mediated transport; it is however unclear whether it is involved in early secretory pathway or intracellular protein transport. Acts as a regulator of neutrophil function, probably via its role in vesicle-mediated transport: required for defense against fungal pathogens and for granulocyte colony-stimulating factor (GM-CSF) signaling pathway; possibly by regulating glycosylation and/or targeting of proteins contributing to the viability and migration of neutrophils.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) uses an alternate splice site in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) is shorter and has a unique C-terminus, compared to isoform 1.