Spink2 (NM_001289767) Mouse Untagged Clone

SKU
MC225486
Spink2 (untagged) - Mouse serine peptidase inhibitor, Kazal type 2 (Spink2), transcript variant 3
  $150.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Spink2
Synonyms 1700007F22Rik; AV038945; HUSI-II
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC225486 representing NM_001289767
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGAGGTCACAGTTCCGAACACCAGACTGTGGTCATTTTGACTTCCCAGCATGCCCTAGGAACCTCA
ACCCTGTGTGCGGAACGGATATGAACACTTACAGCAATGAATGTACCCTGTGCATGAAAATCAGGGAGGA
CGGTAGCCATATTAATATCATCAAAGACGAGCCATGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001289767
Insert Size 180 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001289767.1, NP_001276696.1
RefSeq Size 649 bp
RefSeq ORF 180 bp
Locus ID 69982
UniProt ID Q8BMY7
Cytogenetics 5 C3.3
Summary As a strong inhibitor of acrosin, it is required for normal spermiogenesis. It probably hinders premature activation of proacrosin and other proteases, thus preventing the cascade of events leading to spermiogenesis defects (PubMed:21705336, PubMed:28554943). May be involved in the regulation of serine protease-dependent germ cell apoptosis (PubMed:21705336). It also inhibits trypsin (PubMed:21705336).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 3, which is shorter at the N-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001289767" in other vectors (1)
SKU Description Size Price
MR227697 Spink2 (myc-DDK-tagged) - Mouse serine peptidase inhibitor, Kazal type 2 (Spink2), transcript variant 3 10 ug
$165.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.