Cep250 (NM_008383) Mouse Untagged Clone

CAT#: MC225303

Cep250 (untagged) - Mouse centrosomal protein 250 (Cep250), transcript variant 1, (10ug)

USD 3,842.00


Availability*
10 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cep250 (NM_008383) Mouse Untagged Clone
Symbol Cep250
Synonyms AW490617; B230210E21Rik; Cep2; Inmp
Vector pCMV6-Entry
Sequence Data
>MC225303 representing NM_008383
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGACAGGGAGCCCCGGGTTGAACATGAAGCCCCAGTCCTTGCAGCTGGTGCTGGAGGGGCAGGTGC
TGGCGCTGCAGCAGCAGATGGCCGAGAATCAGGCTGCCTCCTGGCGGAAACTGAAGAACTCCCAAGAGGC
CCAGAAGAGACAAGCAACCCTCGTGAGGAAGCTGCAGGCCAAGGTTTTACAGTACCGGAGCTGGTGTCAA
GACCTGGAGAAGCGACTAGAAGCCACTGGGGGGCTGATCCCTCAGCGCTGGGAGAGTGTAGAAGAGCCCA
ACCTGGAACAGTTGCTGATCCGATTGGAGGAGGAGCAGCAGAGGTGTGAGAGTCTAGTGGAGGTGAACAC
CGAGCTTCGGCTGCACATGGAGAAAGCCGATGTGGTGAATAAAGCCTTGCAGGAGGACGTGGAAAAACTG
ACAGTGGACTGGAGTCGGGCCCGAGATGAGTTAGTGAGGAAGGAGAGCCAGTGGCGGATGGAGCAGGAGT
TCTTCAAGGGCTATTTGAGAGGTGAACACGGTCGTCTTCTCAATCTATGGCGAGAGGTGGTAACCTTCCG
ACGTCACTTCCTGAAAATGAAGTCAGCTACTGACAGAGACCTGACAGAGCTAAAGGCTGAACACGCAAGG
CTTTCAGGGTCCCTGCTGACCTGCTGTCTGCGCCTGACCCTGAGAGCACAGTCTCGGGAGTCCAGTGGAT
CTGGGAGAACAGAGGAGAGTGAGCCAGCCCGGCTGCTGCTGCTCGTCGCTAAGACCCAGGCGCTGGAGAA
GGAAGCCCATGAGAAGAGCCAGGAGTTAATGCAGCTCAAGAGTCACGGGGATCTAGAGAAGGCAGAGCTG
CAGGACCGAGTGACGGAACTCTCTGCTCTGCTAACCCAGTCTCAGAAGCAAAATGAAGATTATGAGAAGA
TGGTAAAGGCTCTAAGAGAAACAATGGAGATCCTGGAGACAAACCATGCAGAGTTAATGGAGCATGAGGC
ATCTCTCAGTAGGAATGCTCAAGAGGAAAAGTTGTCTCTGCAGCAGGTGATCAAGGCTATAACCCAGGCA
CTGGCCTCAGTGGAAGAAGAAGACACTGTGACCCAGTCCTCAGGCCATGAGGACTCGCTGCAGTCAGACT
GTAATGGCCTTTCCCAGTTTGATCCCCAGGACCCAGACAGGGCTCTTACCCTGGTGCAGTCAGTGCTGAC
TCGGAGACAGCAGGCTGTGCAGGACCTCAGGCAGCAGCTTTCAGGCTGCCAGGAGGCTATGAGCTTCTTG
CAGCAGCAGCACGATCAGTGGGAGGAAGAGGGCAGGGCCCTGAGGGAAAAGCTACAGAAGCTCACTGGGG
AGCGGGATGCTCTGGCAGGCCAGACTGTGGGCCTTCAGGGAGAGGTGGACTCTCTCAGCAGGGAGCGGGA
GCTGCTTCAGAAGGCCAGAGGAGAGCTGCAGCAGCAACTGGAAGTGCTGGAGCAGGAAGCGTGGCGACTG
CGGAGGATGAACATGGAGCTGCAGCTGCAGGGGGACTCAGCTCAAGGGGAGAAGCTGGAGCAGCAGGAGG
AGTTGCACTTGGCTGTCCGGGAGAGGGAGCGCCTTCAGGAGACGCTGGTGGGCCTGGAAGCCAAGCAGTC
AGAATCACTAAGTGAGCTGCTCACTCTTCGAGAAGCCCTGGAGTCAAGTCGCCTAGAAGGGGAGTTACTG
AAGCAGGAGCGAGTGGAAGTGGCTGCAGCCTTGGCCAGGGCAGAACAGTCCATTGTGGAGCTGTCAGGTT
CTGAGAACAGCCTGAAGGCAGAGGTAGCTGATCTTCGAGCTGCAGCTGTCAAGCTTGGGGCCTTAAACGA
GGCTTTGGCTTTAGATAAAGTTGAACTGAACCAGCAGCTTCTCCAGTTGGAGCAGGAGAACCAGTCTCTA
TGCAGCAGAGTGGAGGCCGCAGAGCAGCTGAGAAGCGCTTTGCAGGTGGACCTGGCGGAGGCAGAAAGGC
GCAGGGAAGCCCTGTGGGAGAAGAAAACTCAGCTGGAGACTCAGCTGCAGAAGGCAGAGGAAGCGGGGGC
TGAGCTACAGGCAGAGCTGAGGGGCACCCGAGAAGAAAAGGAAGAGCTTAAAGATAAATTAAGTGAGGCA
CATCACCAGCAAGAAACAGCTACAGCTCACCTAGAACAGCTGCATCAGGACGCAGAAAGACAGGAAGAAA
CACTTGCTAGGGCAGTCCAGGAGAAGGAAGCCCTAGTACGGGAGAGGGCAGCTCTTGAGGTGCGCCTGCA
GGCTGTGGAGCGGGACCGACAGGACCTCACTGAACATGTCCTGGGGCTCAGGTCAGCCAAGGAGCAACTG
GAGAGCAATCTATTTGAGGCCCAACAGCAAAATTCTGTGATACAGGTCACCAAGGGGCAGCTGGAGGTCC
AGATTCAAACTATTATCCAAGCCAAGGAAGTAATTCAAGGGGAAGTGAAATGCCTGAAGCTGGAACTGGA
TGCTGAGAGGACCCGGGCAGAGCAGGAGTGGGATGCAGTAGCCAGGCAGCTAGCCCAAGCTGAGCAGGAG
GGGCAAGCATCTCTGGAGCGACAGAAGGTGGCCCACGAGGAGGAGGTGAACAGGCTGCAAGAGAAATGGG
AGAAAGAGCGCTCCTGGCTGCAGCAGGAGCTGGATAAGACCCTGGAAACCCTCGAGAGGGAGAGAGCAGA
GCTGGAGACAAAGCTGAGAGAGCAGCAGACAGAAATGGAAGCCATCCGTGCACAGAGGGAAGAGGAACGA
AGCCAGGCTGACAGCGCCCTGTATCAAATGCAGCTAGAAACAGAGAAGGAGAGAGTATCCCTCCTGGAGA
CACTGCTGAGGACCCAGAAGGAGCTGGCAGATGCTAGTCAACAGCTGGAAAGGCTGAGACAGGACATGAA
GATTCAGAAGTTAAAGGAACAGGAGACCACTGGCATGCTGCAGGCCCAGCTTCAGGAAACACAGCAGGAG
CTGAAGGAGGCAGCCCAGCAGCACAGGGACGACCTTGCTGCCTTCCAGAAGGACAAGCTGGACCTGCAGA
AGCAGGTAGAGGACCTAATGTCTCAGCTGGTAGCCCACGATGACTCCCAGAGGCTGGTGAAAGAAGAGAT
TGAAGAGAAGGTGAAAGTGGCTCAAGAATGCAGCCGGATTCAGAAGGAACTGGAGAAAGAGAACGCCAGC
CTGGCTCTGTCGCTGGTGGAAAAGGAAAAACGACTTCTCATTTTACAAGAAGCTGACTCTGTAAGACAGC
AGGAGCTGAGCTCCTTGCGCCAGGACATACAGGAGGCCCAGGAAGGGCAAAGAGAGCTGGGTGTACAGGT
GGAACTATTGAGGCAGGAGGTGAAGGAAAAGGAGGCTGACTTTGTGGCCCGGGAAGCACAGCTGCTGGAG
GAGTTGGAGGCCTCACGGGTTGCAGAGCAGCAACTTCGAGCGTCTTTGTGGGCCCAGGAAGCCAAGGCAA
CCCAGCTGCAGCTGCAGCTGCGCAGCACTGAGAGCCAGCTAGAGGCATTGGTTGCAGAACAACAGCCGGA
GAACCAGGCACAGGCACAGCTAGCTAGCCTCTGCTCTGTTCTGCAGCAGGCCCTGGGGTCTGCATGTGAG
AGTAGGCCTGAGCTGAGGGGTGGAGGCGACTCTGCTCCTACCTTATGGGGCCCTGATCCAGATCAGAATG
GAGCTTCCAGACTCTTTAAGAGATGGTCGCTCCCAACGGCACTGTCACCGGAGGCTGTGGCACTAGCTCT
CCAGAAGCTCCATCAGGACGTGTGGAAGGCTCGGCAGGCCCGGGATGACCTAAGGGACCAGGTCCAGAAG
CTGGTGCAGCGCCTGACTGACACGGAGGCCCAGAAGAGCCAGGTTCACTCGGAGCTGCAGGACCTGCAGA
GACAGCTCTCTCAGAGCCAGGAAGAGAAATCCAAGTGGGAAGGGAGGCAGAACTCCCTGGAGTCTGAGCT
GAGGGACTTGCACGAGACCGCGGCATCCTTACAGAGTCGCCTCCGGCAGGCAGAACTGCAAAAAATGGAA
GCTCAGAATGATCGAGAGTTGCTTCAGGCATCCAAGGAGAAGCTGTCAGCCCAGGTTGAACATCTGCAAG
CATGTGTTGCAGAAGCCCAGGCTCAGGCAGATGCAGCTGCTGTCCTGGAAGAAGATCTGCGAACTGCTCG
CTCTGCACTGAAACTGAAAAACGAGGAGCTAGAGAGTGAACGGGAGAGAGCCCAGGCTTTACAAGAACAG
GGTGAGCTGAAGGTGGCTCAGGGGAAAGCTTTGCAGGAGAACCTAGCCCTGCTGGCACAGACCCTGTCTA
ACAGAGAGCGGGAGGTCGAGACGTTGCAGGCTGAGGTTCAGGAACTGGAGAAGCAGCGGGAGATGCAGAA
GGCTGCTCTGGAGCTGCTCTCCCTCGACCTGAAGAAGCGCAGTCGGGAGGTAGACCTGCAACAAGAACAG
ATTCAGGAGCTGGAGCAGTGCAGGTCAGTCTTAGAGCACTTGCCCATGGCCGTCCAAGAGCGAGAGCAGA
AACTGAGTGTGCAGCGGGACCAGATCAGGGAACTGGAGAACGATCGGGAGGCCCAGAGGAGTGTCCTGGA
ACACCAGCTTCTGGACCTGGAGCAGAAGGCTCAAGTGATTGAGTCCCAGAGGGGACAGATTCAGGATCTG
AAAAAGCAACTGGGGACACTGGAATGCCTGGCCCTGGAACTGGAGGAAAGCCATCACAAAGTGGAGAGCC
AACAGAAGATGATCACAGAACTAGAGGGCCAGAGGGAAATGCAGAGGGTGGCTCTAACCCACCTCACACT
GGACCTGGAAGAAAGGAGCCAGGAGCTGCAGGCACAAAGCAGCCAGCTCCATGAGCTGGAGAACCATAGC
ACCCATCTGGCAAAAGAGCTGCAGGAGAGGGACCAGGAGGTGACGTCCCAACGCCAGCAGATCGATGAGC
TGCAGAAGCAGCAGGAACAGCTGGCTCAGGCCCTGGAGAGGAAAGGCCAGGAGCTGGTGCTGCAGAAGGA
AAGGATTCAGGTTCTGGAAGATCAGAGGACGCTGCAGACCAAGATCTTAGAGGAGGACCTAGAACAGATC
AAGCATTCCTTGAGAGAACGCAGCCAGGAGCTGGCCTCTCAGTGGCAGCTGGTGCATGAGCGTGCCGACG
ATGGAAAGAGCCCGAGTAAAGGCCAGCGAGGGAGCCTGGAGCACTTGAAGCTGATCCTGCGTGATAAGGA
GAAGGAGGTAGAGTGCCAGCAGGAGCGCATCCAGGAACTTCAGGGCCACATGGGCCAGCTGGAACAGCAG
CTGCAGGGTCTGCACAGGAAGGTGGGGGAGACTAGCCTGCTCCTGACCCATCGAGAGCAGGAGACAGCAA
CCCTGCAGCAGCATCTCCAGGAAGCCAAGGAACAAGGGGAACTGAGAGAGCAGGTACTTCAGGGTCAGCT
GGAGGAGGCCCAGAGAGATCTGGCCCAGAGGGACCATGAACTAGAGACCCTCCGGCAGGAAAAACAGCAG
ACCCAGGACCAGGAGGAAAGCATGAAGCTAAAGACAAGTGCTCTGCAGGCCGCTCTGGAGCAGGCCCATG
CGACACTGAAGGAGCGTCAGGGGGAGCTGGAAGAACACAGGGAACAGGTGCGAAGGCTCCAGGAAGAACT
AGAAGTGGAGGGACGGCAGGTACGGGCCCTGGAGGAGGTGTTGGGGGACCTAAGGGCTGAGTCTCGGGAG
CACGAGAAGGCTGTGCTGGCCCTTCAACAACGGTGTGCTGAGCAGGCCCAGGAACATGAGGCAGAAGCCA
GGACCCTGCAGGACAGCTGGCTGCAGGCCCAGGCCACTCTCACAGAACAAGAACAAGAGCTAGCGGCACT
GCGAGCGGAAAACCAGTATTCCCGCCGACAGGAAGAGGCTGCAGTTAGCCAGGCAGAGGCGCTGCAGGAG
GCCCTCAGCAAAGCCCAGGCTGCCCTGCAGGAGAAAGAGCAGAGTCTGCTTGAACAGGCTGAGTTGAGCC
ACACCCTGGAGGCCAGCACTGCCGCCTTGCAAGCTACCCTGGACACCTGCCAGGCAAGTGCCCGGCAGCT
GGAGGAGGCCCTGAGGATTCGGGAAGGTGAGATCCAGGCCCAGGCTCTCCAACACCACGAGGTCACGCAG
CACCTCCAGCAGGAACTTTGCCAGAAGAAAGAAGAGCTGAGGCAGCTACTAGAGAAGGCTGGGGCCCGGA
GGAGTCAAGAAAATGGAATCCAAGAGAAGCAAAGTCTGGAGCAAGAGAGACAAGAGGAAACAAGGAGGCT
CCTTGAGAGCCTAAAGGAGCTACAGCTGACTGTAGCCCAAAGGGAAGAAGAGATTCTGATGCTGAGGGAG
GCCTCGTCCCCACGCCACAGAGCCCTCCCAGCCGAGAAGCCAGCTCTGCAACCGCTCCCAGCACAACAGG
AGTTAGAGCGGCTGCAGACTGCCCTAAGGCAAACAGAGGCCAGGGAGATTGAATGGAGGGAGAAGGCTCA
GGACCTGGCTCTGTCCCTGGCCCAAAGCAAGGCCAGCATCAGCAGTCTGCAGGAGATAACCATGTTCCTA
CAAGCCTCTGTTCTAGAGCGGGAATCAGAACAACAAAGACTACAGGAGGAGTTGGTACTCAGCAGACAAG
CTCTGGAAGAGCAGCAGTCAGGTGGCCCACACTCAACCAGCAGAGCAGACCAGGGACCAAAAGTGGGACA
GGGAAGCCAGTCTGGAGAGGTAGAGACTGAGCCTAGTCCTGGAGTGGAGGAGAAGGAACGGTTGACACAG
AGGCTTGAACGTCTGCAGCAAGCGGTGGCAGAGCTGGAAGTTGACCGAAGCAAGCTGCAGTGCCACAATG
CGCAGCTGCGGACCGCCTTGGAGCAGGTGGAACGAGAACGGAGGAAGCTGAAGAGGGATTCCGTGCGTGC
ATCCCGGGCAGGATCACTGGAGGCCAGAGAAACTATGACTTCATCCCCCACACAGCAGGATGGGAGAGGC
AGTCAGAGGGGTTCCTCGGACAGCGTGCTTGTGGTTGAGCTTCAGAGAGAGGTAGCCCTGCTGCGAGCCC
AGCTGGCCTTGGAGCGAAAGCAGAGGCAGGACTACATTGCACGGTCCGTGCAGACCAGCCGTGAGCTAGC
AGGCCTGCATCACAGCCTGTCTCACTCCCTCCTCACCGTGGCCCAGGCCCCTGAGGCCACTGTTCTGGAG
GCTGAGACCCGAAAGCTGGATGAGTCTCTGAATCAGAGTCTGACATCCCCAGGGCCATGTTTGCTACATC
CCAGTCTGGACACTACTCAAAATACCCACAGGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_008383
ORF Size 7245 bp
Insert Size 7245
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_008383.3, NP_032409
RefSeq Size 7919
RefSeq ORF 7245
Locus ID 16328
Cytogenetics 2|2 H1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.