Col14a1 (NM_181277) Mouse Untagged Clone

CAT#: MC224929

Col14a1 (untagged) - Mouse collagen, type XIV, alpha 1 (Col14a1), (10ug)

USD 2,854.00


Availability*
8 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Col14a1 (NM_181277) Mouse Untagged Clone
Symbol Col14a1
Synonyms 5730412L22Rik; AW108078
Vector pCMV6-Entry
Sequence Data
>MC224929 representing NM_181277
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGATTTGGCAGTGCAAGATGCGGGACTGGCTGATTCTAGCTTTTTTGGCGGCTGCTTGTTTCTGCA
CCATTGTCAGGGGACAAGTGGCTCCACCCACAAGGTTAAGATATAATGTGATTTCCCATGATAGTATACA
GATTTCATGGAAAGCACCAAGAGGGAAATTTGGTGGCTACAAACTGCTCGTGGCTCCAGCTTCAGGAGGA
AAGACCAACCAGATGAATCTCCAGAACACTGCAACAAAAGCGATTATTCAAGGCCTTCTGCCAGAGCAGA
ACTACACAGTTCAACTCATTGCCTACTATAAAGACAAGGAAAGCAAGCCCGCTCAAGGCCAGTTCAGAAT
TAAAGATTTAGAGAAAAGAAAGGATCCAACAAAGCCCAAAGTCAAGGTTGTGGACAAAGGAAATGGAAGT
AAACCAACTTCACCAGAAGAGGTAAAATTCTTCTGTGAGACTCCAGCCATCGCTGACATCGTCATCCTGG
TGGATGGGTCGTGGAGTATTGGGAGGTTCAACTTCAGGCTTGTGCGCAATTTCTTGGAAAACCTGGTCAC
AGCGTTCAACGTGGGCTCAGAAAAGACAAGAATCGGCTTGGCACAGTACAGTGGGGACCCCAGAATAGAG
TGGCACTTGAATGCCTTTAACACAAAAGATGAGGTGATTGATGCTGTCCGAAGCCTTCCATACAAAGGAG
GAAATACCCTAACAGGTCTTGCTTTGAACTTTATTTTTGAGAATAGCTTTAAACCAGAAGCAGGATCGAG
GAGTGGAGTTTCCAAGATTGGCATTTTGATCACAGATGGAAAATCCCAGGATGATATTATCCCACCATCT
AGAAACCTCCGTGAGTCTGGTGTAGAGCTGTTTGCCATAGGGGTTAAAAATGCCGACCTGAGTGAGCTGC
AGGAGATCGCCTCTGAGCCAGACAGCACCCATGTGTACAATGTTGCTGAGTTCGACCTGATGCACACAGT
GGTGGAGAGCCTGACCCGGACTGTATGCTCTAGAGTGGAAGAGCAGGACAAGGAGATTAAAGCCTCAGCC
CTTGCCACCATCGGGCCACCTACAGAGCTGATCACTTCTGAAGTCACTGCCAGGAGCTTTATGGTTAACT
GGACTCAGTCCCCAGGAAAAGTGGAAAAATACAGAGTTGTGTATTATCCCACCAGAGGCGGAAAGCCGGA
GGAGGTGGTGGTGGATGGGAGTGTATCTTCCACAGTGTTGAAAAACTTGATGTCTTCAACTGAGTACCAG
ATAGCAGTGTTTGCAGTATCTGCCCACACAGCTAGTGAAGGCCTGCGGGGAGCAGAGACCACATTGGCCT
TGCCCATGGCTTCCGACCTCGAGCTGTACGACGTGACTGAGAACAGCATGCGCGTCAGGTGGGATGCAGT
ACCTGGAGCCACAGGCTATCTGATCCTCTATGCTCCTCTCACAGAAGGTCTGGCTGGAGATGAGAAAGAG
ATGAAAATTGGAGAGACACACACAGACATTGAACTGAGTGGGCTATTCCCCAATACAGAATATACAGTCA
CTGTGTATGCCATGTTTGGAGAAGAGGCCAGCGATCCTGCTACAGGACAAGAGACAACCCTACCCTTAAC
CCCACCAAGAAATTTGCGGATCTCCAATGTTGGCTCTAACAGCGCTCGGTTAACCTGGGACCCCGCATCG
GGAAAGATCAGTGGTTACAGAATTGTGTATACCAGTGCAGACGGGACAGAAATCAATGAGGTTGAAGTCG
ATCCTATCACTACATTCCCTCTGAAAGGCTTGACCCCCCTCACGGAGTACTCCATTGCAATCTTCTCCAT
CTACGAGGAGGGGCAGTCCTTGCCCCTGGTTGGAGAGTTTACCACAGAGGAAGTTCCCGCCCAGCAATAC
TTGGAAATTGATGAGGTGAAGACAGACAGTTTTCGAGTGACTTGGCATCCGCTCTCCGCTGAGGAGGGGC
AGCACAAGCTGATGTGGATTCCGGTCTATGGCGGGAAGACCCAGGAGGTTGACCTCAAAGAAGAACAGGA
CTCTTATGTTATTGAAGGCCTGGATCCTGGAACCGAGTACGAAGTCTCCCTGTTAGCTGTGCTTGATGAC
GGAAGCGAGAGTGAGGTGGTGACCGCAGTGGGAACCACACTTGATGATTTTTGGACTGAAGCACCCACAG
CCATAGAACCTACCAGCCCTGTGACTTCAGTTCTCCAGACAGGAATCAGAAACCTGGTTGTAGATGACGA
AACTGCTACTAGCCTGCGGGTATCGTGGGACATTTCTGACAGCAATGTGGAGCAGTTTAGGGTGACCTAC
CTGAAAGCCCAAGGGGACCCTATGGAAGAAGTGGTTATGGTGCCTGGAGTGCAAAACAGTCTCCTTCTGA
AGGCTCTACTTCCAGACACTGAGTATAAAGTCACAGTAACCCCTGTCTATACTGTTGGAGAAGGCGTCAG
CGTCTCCGCTCCAGGGAAGACTTTGCCCTCCTCTGGTCCTCAAAACCTGAGGGTCTCAGAAGAATGGTAC
AACCGGGTGCGCATTACATGGGACCCACCCTCTGGCCCCGTGAAGGGCTATAGGATTGTCTACAAACCTG
TGAGTGTCCCTGGTCAAACTCTGGAGACCTTCGTGGGTGCTGACATCAACACCATTGTCATGACAAATCT
CCTCAGTGGAATGGACTACAATGTGAAGATCTTTGCTTCCCAGGCGTCAGGCTTCAGTGATGCTCTGACT
GGCCTCGTGCAAACACTGTTCTTAGGGGTGACAGATCTCCAAGCCAATCAGGTTGAAATGACAAGCTTGT
GTGCTCGGTGGCAAATACATCGCCATGCCACAGCCTACAGGATAGTTCTAGAATCCCTTCAGGACACACA
AGCACAGGAATCCACGGTGGGAGGAGGCGTAAACAGGCATTGCTTCTATGGACTTCAGCCTGATTCAGAG
TATAAAATCAGTGTTTACACAAAGCTCCAGGAGCTAGAGGGACCCAGTGTGAGCATCATGCAGAAAACAC
AGTCACTTCCCACGGAACCACCGACTTTTCCTCCAACCATCCCACCAGCAAAGGAAGTATGTAAAGCTGC
CAAGGCAGACCTGGTATTCATGGTGGATGGATCTTGGAGCATAGGAGATGACAATTTCAATAAAATCATC
AATTTTCTATACAGCACTGTGGGAGCCCTGGACAAGATTGGTGCAGATGGAACTCAGGTGGCAATGGTTC
AGTTCACTGATGACCCCCGAACAGAATTCAAACTTGATTCTTACAAAACCAAAGAGACCCTTCTTGATGC
AATTAGACACATTTCCTACAAAGGAGGAAATACTAAAACAGGAAAAGCTATCAAGCATGTTCGGGATACC
TTATTTACATCAGACTCAGGGACAAGGAGAGGCATCCCAAAGGTCATCGTGGTGATAACTGATGGACGGT
CACAAGATGATGTCAACAAAATCTCCAGGGAGATGCAGGCAGATGGTTTCAACATCTTTGCCATCGGTGT
GGCTGACGCTGACTACTCCGAGTTGGTTCAGATCGGCAGCAAGCCCAGCTCACGGCATGTCTTCTTTGTG
GATGACTTTGATGCCTTTAAGAAAATTGAAGATGAATTGATTACTTTTGTCTGTGAAACTGCATCAGCAA
CCTGCCCAATGGTGCACAAGGATGGAGTTGATCTTGCAGGGTTTAAGATGATGGAAATGTTTGGTTTGGT
TGAAAAGGACTTTTCTGCAGTGGAAGGAGTATCTATGGAACCTGGTACCTTCAATTTGTTCCCATGCTAT
CAAATCCATAAGGATGCTCTGGTTTCTCAGCCAACAAAGTATCTGCACCCAGAAGGATTGCCTTCTGACT
ATACAATGAGTTTCCTGTTCCGGATTCTTCCTGACACACCACAGGAGCCATTTGCTCTTTGGGAGATTTT
AAACAAAAATTCTGAGCCGCTAGTTGGGATCATATTGGACAATGGTGGGAAAACTCTAACTTATTTCAAC
TATGACTATACTGGAGATTTTCAAACTGTCACTTTTGAAGGACCCGACATCAGGAAAATGTTCTATGGAA
GCTTTCACAAGCTCCATGTTGTTGTCAGCAAGACTCTGGCCAAAGTGGTTGTTGACTGCAAGGAAGTTGG
TCAGAAGGCAATAAATGCATCAGCGAATATCACATCGGATGGTGTGGAAGTACTAGGAAGAATGGTCAGA
TCAAGAGGACCAAATGGAAACTCTGCACCATTCCAGTTACAAATGTTTGATATCGTTTGCTCTACATCAT
GGGCCAGTAAAGACAGATGCTGCGAACTTCCTGGTCTGCGGGATGAAGAGTCCTGCCCAGACCTTCCACG
GTCCTGCTCTTGCTCGGAAACCAATGAAGTGGCTCTAGGACCAGCTGGCCCCCCAGGTGGTCCAGGACTC
CGAGGACCAAAAGGCCAACAAGGTGAACAGGGTCCGAAGGGACCAGAGGGACCTCGGGGAGAAACAGGTC
CTGCAGGACCCCAGGGCCCCCCTGGACCCCAGGGACCTAGTGGTCTGTCCATTCAAGGCATGCCTGGAAT
GCCGGGTGATAAAGGAGATAAAGGAGATGCTGGTCTTCCTGGTCCACAGGGTGTCCCTGGAGGTGTTGGT
TCACCAGGCCGTGATGGCTCACCAGGCCAGAGGGGATTTCCCGGGAAGGACGGTTCCTCTGGGCCTCCAG
GACCACCTGGGCCAATTGGCATTCCTGGAGCCCCTGGTGTCCCAGGGATCACAGGCAGCATGGGACCGCA
AGGAGCCCTGGGGCCACCTGGTGTCCCTGGAGCGAAGGGAGAGCGAGGTGAACGGGGAGACCTGCAGTCT
CAAGCCATGGTGAGGGCGGTGGCACGTCAAGTATGCGAGCAGCTCATTCAGAGTCACATGGCCAGGTACA
CAGCCATCCTCAACCAGATCCCCAGCCAGTCCTCATCTATCCGGACCATCCAGGGCCCTCCTGGGGAGCC
CGGGAGACCAGGTTCACCTGGAACCCCTGGAGAACAAGGACCCCCAGGTACCCCAGGCTTCCCAGGAAAT
GCAGGAGTTCCGGGGACCCCAGGAGAACGAGGTCTAACTGGTGTCAAAGGAGAGAAAGGAAATCCAGGCA
TTGGAACTCAAGGCCCAAGAGGTCCCCCTGGGCCAGCAGGACCTTCAGGGGAAAGTCGTCCTGGAAGTCC
TGGGCCACCTGGCTCTCCTGGACCAAGGGGTCCCCCGGGCCACCTGGGAGTACCTGGACCTCAGGGTCCT
TCTGGCCAGCCTGGGTATTGTGACCCCTCCTCGTGCTCTGCTTATGGCGTTGGAGTGTCCCATCCTGATC
AGCCTGAGTTCACACCGGTCCAGGACGAGCAGGAGGCCATGGATCTGTGGAGCGCAGGCATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_181277
ORF Size 5385 bp
Insert Size 5385
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_181277.3, NP_851794
RefSeq Size 6465
RefSeq ORF 5385
Locus ID 12818
Cytogenetics 15|15 D1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.