Kat6b (NM_017479) Mouse Untagged Clone

CAT#: MC224917

Kat6b (untagged) - Mouse MYST histone acetyltransferase monocytic leukemia 4 (Myst4), transcript variant 1, (10ug)

USD 2,812.00


Availability*
7 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Kat6b (NM_017479) Mouse Untagged Clone
Symbol Kat6b
Synonyms AI507552; B130044K16Rik; mKIAA0383; Morf; MYST-4; Myst4; qkf; querkopf
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC224917 representing NM_017479
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTAAAACTTGCAAACCCACTTTACACAGAGTGGATTCTTGAAGCAGTGCAGAAAATCAAGAAGCAGA
AGCAGCGGCCCTCAGAAGAGAGGATCTGCCATGCGGTCAGCACGTCCCATGGGTTGGACAAGAAAACAGT
CTCGGAACAGCTGGAACTTAGTGTTCAGGATGGCTCCGTTCTCAAAGTCACCAACAAAGGCCTTGCTTCA
TATAAGGACCCAGACAATCCTGGGCGTTTTTCATCGGTTAAACCGGGCACTTTCCCCAAGCCAACCAAGG
GGTCCAAAGGACCGCCGTGTAATGATCTACGCAATGTGGATTGGAATAAACTTTTAAAGAGAGCAATCGA
AGGCCTTGAGGAGCCAAACGGCTCCTCCTTGAAGAACATTGAGAAGTATCTGAGAAGCCAGAGTGATCTT
ACAGGCACCACCAACCATCCAGCCTTTCAGCAGAGGTTGCGGCTAGGGGCCAAGCGTGCTGTGAACAATG
GGAGGTTACTGAAGGAAGGACCACAGTACAGGGTCAATAGTGGGAGCTCAGATGGCAAAGGGGCGCCCCA
GTACCCCAGTGCTTTTCCGTCCTCACTCCCGCCCGTCAGCCTTCTACCCCATGAGAAAGACCAGCCCCGT
GCCGATCCCATTCCAATATGTAGCTTCTGTTTGGGGACTAAAGAGTCAAATCGTGAAAAGAAACCAGAAG
AACTCCTGTCTTGTGCAGATTGTGGCAGTAGTGGACACCCATCCTGTCTGAAGTTTTGTCCTGAGTTAAC
CGCAAATGTGAAGGCCTTGAGGTGGCAGTGCATCGAGTGCAAGACGTGCAGCGCATGTCGAGTCCAGGGC
AAAAATGCAGATAACATGCTTTTTTGTGATTCCTGTGATAGAGGATTCCATATGGAGTGCTGTGACCCAC
CACTTTCCAGAATGCCAAAAGGGATGTGGATTTGCCAAGTCTGCAGACCAAAGAAAAAGGGAAGAAAACT
ACTTCATGAGAAAGCTGCACAAATAAAACGGCGATATGCAAAACCCATTGGACGACCGAAAAATAAATTA
AAGCAACGATTGTTGTCTGTAACCAGTGATGAAGGATCCATGAGTGCATTCACAGGAAGGGGGTCACCTG
ATACTGATATTAAAATAAGCATCAAACAAGAAAGTGCAGATGTGAGTCTGGTGGGAAACAAGGAGCTCGT
GACTGAAGAGGATCTGGACGTTTTTAAGCAGGCCCAGGAACTGTCTTGGGAGAAAATAGAGTGTGAAAGT
GGAGTGGAAGACTGTGGTCGGTACCCCTCAGTAATAGAGTTCGGGAAATACGAGATCCAAACCTGGTACT
CCTCGCCTTACCCACAGGAATATGCAAGATTACCAAAGCTTTACCTGTGTGAATTCTGTCTTAAATATAT
GAAGAGTAAAAATATTTTGCTAAGACACTCAAAGAAGTGTGGATGGTTTCATCCTCCGGCCAATGAGATT
TACCGAAGGAAAGACCTTTCAGTATTCGAGGTTGATGGGAATATGAGTAAAATTTATTGCCAAAACCTTT
GCTTGTTAGCCAAGCTCTTCCTGGACCACAAAACATTGTATTATGATGTTGAGCCATTCCTTTTTTATGT
CCTTACAAAAAATGATGAAAAAGGCTGTCATCTGGTTGGATACTTCTCCAAGGAAAAGCTCTGCCAGCAG
AAGTATAATGTGTCCTGCATAATGATCATGCCCCAGCACCAAAGGCAAGGATTTGGACGCTTTCTCATTG
ATTTCAGCTATTTGCTTTCTCGAAGAGAAGGCCAAGCAGGGTCTCCCGAAAAGCCGCTCTCTGACCTGGG
CCGGCTCTCCTACCTGGCCTACTGGAAAAGTGTCATCTTGGAATACCTCTACCGCCACCACGAGAGGCAC
ATCAGCATCAAGGCCATTAGCAGAGCCACAGGCATGTGCCCACATGACATCGCCACCACTCTGCAGCACC
TCCACATGATTGACAGGAGGGATGGCAGGTTTGTCATCATTAGAAGGGAAAAGTTGATATTGGGCCACAT
GGAAAAGCTGAAGAACTGTTCCCGACCCAATGAACTTGATCCGGAGAGTCTAAGATGGACCCCAATGTTA
ATTTCTAATGCTGTGGTTTCTGAGGAAGAGCGAGAAGCTGAGAAGGAGGCTGAACGACTAATGGAACAAG
CCAGCTGCTGGGAGAAGGAGGAGCAAGAGATCCTGTCGTCCAGAGTTAGCAGTAGGCAATCGTCTGCAAA
AGTACAATCAAAGAATAAGTACCTGCACTCCCCAGAGAGGCGGCCAGTGGCCGGGGAGCGAGGACAGTTG
TTAGAGCTGTCCAAAGAGAGCAGTGAGGAAGAGGAGGAGGAGGAGGAGGAAGATGATGAGGAAGAGGAGG
AGGAGGAAGAGGAGGAGAGCATTCAGACATCTCCCCCTCGGTTGACTAAGCCACAGTCAGTTTCCATTAA
AAGAAAGAGGCCTTTTGTAGTAAAGAAGAAAAGGGGTCGTAAACGCAGGAGGATCAACAGCAGTGTCACC
ACCGAGACCATTTCCGAGACGACAGAAGTGCTCAATGAGCCCTTCGACAACTCGGATGAGGAGAGGCCAA
TGCCGCAGCTGGAGCCTACCTGTGAGATCCCAGTGGAGGAGGGCGGCAGGAAGCCAGTTCTGAGGAAAGC
ATTCCCACATCAGCCAGGGAAGAAAAGGCAGACAGAGGAAGAGGAAGGGGAAGACAATCATTTCTTCAAG
ACCGCTGCCCTTTGTAGAAAAGATGTAGATGATGATGCAGAACACTTGAAAGAAGGCAGCAAAGACAATC
CTGAGCCTCTAAAGTGCAGACAAGTGTGGCCAAAAGGAGCGAAGCGAGGGCTCTCCAAGTGGAAGCAAAG
CAAGGAGAGGAAGACGGGCTTCAAGCTGAACCTGTACACCCCACCAGAGACACCCATGGAGCCAGAGGAC
CAGGTGACGATCGAAGAGCAGAAGGAGCTTTCAGAGGACAAGGGCAGCCCCGTGGGGATGGAACGGGAGG
TGACAGAGACCGTGGATGCCTTGCTGCCTCAGGAGGGGAGCAGAAGGGAAGAGACAGGCATACCCGTGAG
TCCACATAAATCACCAGGTGGAAAGGTAGATGAGGAGGACCTCATCAGAGGTGAGGAGGAGGGAGAGGAA
GAGGGAGAGGAGGAGGGAGAACGAGAAGAACAGGAAGAGGAAGAAGAAGTAACTACAGAAAAAGACCTAG
ATGGTGCTAAAAGTAAAGAGAACCCGGAGCCTGAGATCTCCATGGAAAAGGAAGACCCTGTGCATCTGGG
TGACCATGAAGAGGACGAGGATGAGGAGGAAGAGCCATCTCACAATGAGGACCATGATGCAGATGATGAA
GATGATGGCCACATGGAGGCTGCCAACATGGAGAGGGGAGACCTCCCAAGAGAAACCTTCAAAGACGCAC
TAGAGGGCCAGGAGGCTTTTTTAGACCTGAGCATTCAGCCGAGTCACTCGAACCCTGAAGTCTTGATGAA
CTGCGGTGTTGATCTCACAATGTCCTGTAACAGTGAGCCAAAGGAGCTTGCTGGGGACACTGGAACTGCA
CCTGAGTCTGACGCGGAGCCCCCGGAAGAACAGACACAGAAGCAGGACCAAAAGAACAGCGATGGTGTGG
ATGCTGAGCTCGAAGAGGGAGGCCCAGCCGCTGTGGAAATTGACTCCGAGACCGCCCAGGCTGTTCAGTC
TTTGACCCAAGAAAACAGGGAGCACGATGACACCTTTCCAGATTGTGCTGAGACTCAAGAGGCCTGTAGA
AGCCTGCAGAACTATACACACACAGACCAAAGTCCTCAAATTGCCACCACGCTGGACGAGTGCCAACAGT
CAGACCACAGTAGCCCAGTTTCATCTGTCCATTCCCATCCTGGCCAGTCAGTTCGTTCTGTCAATAGCCC
CAGTGTCCCTGCCCTAGAGAATAGCTATGCCCAAATCAGCCCCGATCAGACTGCCATCACAGTGCCACCT
CTGCAGAACATGGAGACCAGTCCAATGATGGACGTCCCGTCAGTGTCAGATCACTCACAGCAGGTCGTTG
ACAGCGGATTCAGTGACCTGGGCAGTATTGAGAGCACAACAGAGAACTATGAGAACCCAAGCAGCTATGA
CTCAACCATGGGAGGCAGTATCTGTGGAAACGGCTCTTCCCAGAACAGCTGCTCCTACAGCAGTCTCACC
TCTAGCAATCTGACACAGAACAGCTGTGCTGTCACCCAGCAGATGTCCAACATCAGTGGGAGCTGCAGCA
TGCTGCAGCAGACCAGCATCAGCTCCCCTCCAACCTGCAGCGTCAAGTCTCCCCAAGGCTGTGTGGTGGA
GAGGCCTCCCAGTAGCAGCCAGCAGCTGGCTCAGTGCAGCATGGCCGCCAATTTCACCCCACCCATGCAG
CTGGCTGACATCCCCGAGACCAGCAATGCCAACATTGGCTTATATGAGCGAATGGGTCAAAGTGATTTTG
GGGCTGGGCACTACCCACAGCCATCTGCCACCTTCAGCCTTGCCAAACTGCAGCAGTTAACTAATACACT
TATTGATCATTCATTGCCTTACAGCCATTCCGCTGCTGTGACCTCCTATGCAAACAGTGCCTCTTTGTCC
ACACCATTAAGTAACACAGGGCTTGTTCAGCTTTCGCAGTCTCCACACTCTGTCCCTGGAGGGCCCCAAG
CACAAGCTACCATGACCCCACCCCCTAACCTGACTCCTCCTCCCATGAATCTGCCACCACCTCTCCTGCA
GCGGAACATGGCTGCATCAAATATTGGCATCTCCCACAGCCAAAGACTGCAAACTCAGATTGCCAGCAAG
GGCCACGTCTCCATGAGAACCAAGGCGGCATCTCTGTCACCAGCTGCCGCCACCCATCAGTCACAAATCT
ATGGGCGTTCCCAGACTGTAGCCATGCAGGGTCCTGCACGGACTTTAACGATGCAAAGAGGCATGAACAT
GAGTGTGAACTTGATGCCAGCGCCAGCCTACAATGTCAACTCGGTGAACATGAACATGAACACTCTGAAT
GCCATGAATGGGTATAGCATGTCCCAGCCGATGATGAACAGTGGTTACCACAGCAACCACGGCTATATGA
ATCAAACCCCCCAGTACCCTATGCAGATGCAGATGGGCATGATGGGAAGCCAGCCATACGCCCAGCAGCC
AATGCAGACCCCACCCCACGCTAACATGATGTACACGGCCCCCGGACACCACGGCTACATGAACACAGGC
ATGTCCAAACAGTCTCTCAATGGGTCCTACATGAGAAGGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_017479
ORF Size 5292 bp
Insert Size 5292
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_017479.3, NP_059507
RefSeq Size 7347
RefSeq ORF 5292
Locus ID 54169
Cytogenetics 14|14 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.