Abca5 (NM_147219) Mouse Untagged Clone

CAT#: MC224780

Abca5 (untagged) - Mouse ATP-binding cassette, sub-family A (ABC1), member 5 (Abca5), (10ug)

USD 2,091


Availability*
7 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Abca5 (NM_147219) Mouse Untagged Clone
Symbol Abca5
Synonyms ABC13; B930033A02Rik; mKIAA1888
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC224780 representing NM_147219
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTACTGCAATTAGGGATGTGGGAGTTTGGAGACAGACCAGAACACTTCTACTGAAAAATTACCTAA
TTAAATGCAGGACTAAAAAAAGTAGTGTTCAGGAAATTCTTTTTCCTCTATTTTTCTTATTTTGGCTGAT
ATTAGTTAGCATGATGCATCCAAATAAGAAATATGAAGAGGTATCTGATATAGAGCTCAGCCCTATGGAC
AAATTCAGCCTTTCCAACGTTATTCTTGGATACACTCCCGTGACTAACATTACAAGCAGCATTATGCAGA
GGGTTTCTACCGATCATCTTCCCAAGGTTATAGTTACTGAAGAATACGCAAATGAGAAAGAACTGGTAGC
CGCAAGTCTTTCTAAGTCCAGCAACTTCGTAGGTGTGGTTTTCAAAGACACCATGTCCTATGAACTTCGT
TTTTTTCCTGAAATGATTCCAGTGTCTTCTATTTATATGAATTCAAGAGAAGGCTGTTCAAAGACATGTG
ATGCTGCTCAGTACTGGTCTTTGGGGTTTACAGTTCTGCAGGCATCGATAGATGCTGCCATTATACAGCT
GAAGACCAATGTTTCTGTGTGGAGCGAGCTGGAGTCGACCAAAGCTGTGATCATGGGAGAGGCCGCTGTT
GTGGAGATTGACACCTTCCCGCGAGGGGTCATCCTCATCTACCTCGTCATAGCCTTCTCGCCCTTCGGCT
ACTTCCTGGCAATCCACATCGTGGCAGAAAAAGAAAAGAAGTTAAAGGAATTTTTAAAGATAATGGGACT
TCATGACACTGCTTTTTGGCTTTCCTGGGTTCTTCTGTACGCAAGCTTGATTTTCCTTATGTCCCTGCTT
ATGGCTGTCATCGCAACAGCTTCTTCGTTATTCCCTCAGAGTAGCAGCATTGTGATCTTTCTACTGTTCT
TCTTATATGGATTGTCATCTGTGTTTTTTGCTTTAATGCTGACGCCTCTTTTTAAAAAATCAAAACACGT
GGGAGTCGTTGAGTTTTTTGTCACCGTGGTGTTTGGATTTGTTGGCCTGCTGATTGTCCTCATAGAAAGT
TTCCCCAGGTCGCTGGTGTGGCTCTTCAGTCCTTTGTGTCAGTGTGCCTTTCTGATTGGGATTGCACAGG
TCATGCATTTAGAAGATTTTAATGAGGGTGCCTTATTTTCTAATTTGACTGAAGGTCCCTATCCTCTAAT
TATTACTATTATCATGCTAGCTCTTGACAGTGTGTTCTATGTCCTCCTGGCTGTGTATCTCGACCAAGTC
ATTCCAGGGGAATTTGGCTTGAGGAGGTCATCTTTGTATTTTTTGAAGCCATCGTATTGGTCAAAAAACA
AAAGAAACTATAAGGAGCTATCGGAGGGCAACATTAATGGCAATATTAGTCTCAATGAAATTGTTGAGCC
CGTTTCTTCAGAATTTATAGGGAAAGAAGCTATAAGAATAAGTGGTATTCAGAAATCCTATAGAAAGAAA
ACTGAGAACGTGGAGGCTTTGAGAAATTTGTCATTTGACATATATGAAGGTCAGATTACTGCACTGCTGG
GCCACAGTGGAACAGGAAAAAGCACACTGATGAATATTCTGTGTGGACTGTGTCCACCCTCTGATGGGTT
TGCTTCTATATATGGACACAGAGTCTCTGAAATAGATGAAATGTTTGAAGCAAGAAAAATGATTGGCATA
TGTCCGCAGTCAGATATAAACTTTGATGTTCTGACAGTAGAAGAAAATTTATCAATTTTGGCTTCAATCA
AAGGAATACCAGCCAACAATATAATTCAAGAAGTGCAGAAAGTGTTGCTGGATCTGGACATGCAAGCCAT
CAAAGATAATCAAGCGAAAAAGTTAAGCGGTGGTCAGAAAAGGAAGCTGTCTGTAGGAATTGCAGTTCTC
GGGAATCCAAAGATACTCCTGCTAGACGAGCCTACAGCAGGAATGGACCCCTGCTCTCGCCATATTGTTT
GGAATCTTCTAAAGTATAGAAAGGCTAACAGAGTGACCGTGTTTAGTACTCACTTCATGGATGAGGCTGA
CATTCTTGCCGACAGGAAAGCTGTCATATCACAAGGAATGCTGAAGTGTGTTGGTTCTTCAATTTTCCTA
AAGAGTAAATGGGGAATCGGCTACCGCCTGAGCATGTATATAGACAGATACTGTGCCACAGAGTCACTGT
CGTCGCTGGTTAGGCAGCACATACCCGCAGCCGCGCTACTGCAGCAGAATGACCAGCAGCTCGTGTACAG
CCTGCCTTTCAAAGACATGGACAAATTTTCAGGCTTGTTTTCTGCTCTAGACATTCATTCAAACCTGGGT
GTTATTTCTTATGGTGTTTCCATGACAACATTGGAAGATGTATTCTTAAAGCTAGAAGTTGAAGCAGAAA
TTGACCAAGCAGACTATAGTGTATTTACACAGCAGCCGCGGGAGGAAGAAACAGATTCAAAATCCTTTGA
TGAAATGGAACAGAGTTTACTTATTCTCTCTGAAACGAAAGCTTCTTCAGTGAGCACCATGAGCCTCTGG
AAGCAGCAAGTGTCTACGATTGCAAAGTTTCATTTCCTCTCATTGAAACGAGAAAGCAAATCAGTGCGCG
CTGTGTTGCTTCTGCTTTTAATTTTTTTTGCAGTTCAGATTTTTATGTTTTTTCTCCATCATTCTTTTAA
AAATGCTGTGGTTCCCATCAAACTCGTTCCAGACTTGTATTTCCTAAAGCCTGGAGATAAACCTCATAAA
TACAAAACAAGCCTGCTGCTTCAAAATTCTACTGACTCAGATATCAATGGTCTTATTGAGTTTTTTGCAC
ACCAGAACATAATGGTGGCAATGTTTAATGACAGTGACTATGTGTCTGCTGCTCCTCACAGTGCGGCTCT
CAATGTGGTGCGTTCTGAAAAGGACTATGTTTTTTCTGCTGTTTTCAACAGTACTATGGTTTATTGTTTG
CCAGTCATGATGAACATCATTAGTAACTACTATCTTTATCATTTAAATGTGACTGAAGCCATCCAGACCT
GGAGTACCCCGTTCATTCAAGAAATTACTGACATTGTTTTTAAAATTGAGCTATATTTTCAAGCAGCTTT
GCTTGGAATCATTGTTACTGCAATGCCACCTTACTTTGCCATGGAAAATGCAGAGAATCATAAGATCAAA
GCTTATACTCAACTTAAACTTTCGGGTCTTTTGCCATCAGCCTATTGGGTTGGACAAGCTGTTGTGGATA
TTCCCTTGTTTTTTGTTGTTCTGATTTTGATGCTGGGAAGTTTATTTGCATTTCATCATGGACTGTATTT
TTATCCTGCAAAATTTCTTGCTGTGGTGTTTTGCCTCATTGCTTATGTGCCCTCCGTCATTCTGTTCACG
TACATAGCTTCGTTCACTTTCAAGAAAATTTTAAATACCAAGGAATTTTGGTCATTTATCTATTCTGTGA
CCGCATTGGCTTGTGTGGCAATCACGGAAACAACTTTCTTTCTGCAATATGCAGTTACGGCTGTCTTTCA
TTACACCTTCTGCATAGCCATTCCAATCTACCCTCTCCTGGGTTGTCTGATTTCTTTCATAAAGGGTTCT
TGGAAGAATATGCCAAAAAATGAGAATACCTACAATCCCTGGGATAGACTTTTAGTTGCTGTAATCATGC
CCTACCTGCAGTGTATACTGTGGATTTTCCTCTTACAACACTATGAGAAAATACATGGAGGCAGATCTAT
AAGAAAGGATCCATTTTTCAGGGCCCTTTCACAAAAGGCCAAAAATAAGAAGTTTCCAGAACCACCCATC
AATGAGGATGAAGATGAAGATGTCAAAGCTGAAAGACTGAAGGTTAAAGAGCTGATGGGTTGCCAGTGTT
GTGAGGAGAAGCCAGCCATTATGGTATGCAATTTGCATAAAGAGTATGATGACAAGAAAGATTTTCTTCA
TTCAAGAAAAACAACAAAAGTAGCAACAAAATACATCTCTTTCTGTGTGAAAAAAGGAGAGATCTTGGGA
CTGTTGGGTCCAAATGGAGCTGGCAAAAGCACAGTCATTAACACTCTGGTTGGGGACGTTGAGCCAACTT
CAGGCAAGATCTTTCTAGGAGATTATGGTTCACATTCAAGTGAAGATGACGAATCCATTAAGTGTATGGG
GTACTGCCCCCAGACAAACCCACTGTGGCCAGATCTCACTCTACAGGAACATTTTGAGATTTACGGAGCT
GTGAAAGGAATGAGTCCTGGTGACATGAAGGAAGTCATCAGTCGAATAACAAAAGCCCTTGATTTGAAAG
AACATCTTCAGAAGACTGTAAAGAAGCTACCTGCAGGGATCAAGCGAAAGCTGTGTTTTGCTCTCAGCAT
GCTGGGGAACCCTCAGGTGACGCTGCTGGATGAGCCGTCCACAGGCATGGACCCAAGAGCCAAGCAGCAC
ATGTGGAGAGCTATTCGAACTGCATTTAAAAACAAAAAGCGGGCCGCCCTCCTGACTACTCATTACATGG
AAGAGGCAGAGGCTGTCTGTGACAGAGTGGCCATCATGGTATCTGGGCAGCTAAGATGTATTGGAACAGT
ACAACATCTAAAGAGTAAGTTTGGTAAAGGCTACTTTTTGGAAATTAAATTAAAGGACTGGATAGAAAAC
CTGGAAATAGATCGCCTTCAAAGAGAAATTCAATATATTTTCCCAAATGCAAGCCGCCAAGAGAGCTTTT
CTTCTATTTTGGCTTTTAAAATTCCAAAAGAAGATGTTCAGTCTCTCTCACAATCCTTCGCTAAGTTGGA
AGAAGCAAAACGCACTTTTGCCATTGAAGAATACAGCTTTTCTCAAGCAACCCTGGAACAGGTTTTTGTA
GAACTTACTAAAGAGCAAGAGGAAGAAGATAACAGCTGTGGGACTTTGGCCAGCACTCTCTGGTGGGAAA
GGACGCAGGAGGATAGAGTAGTATTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_147219
ORF Size 4929 bp
Insert Size 4929
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_147219.2, NP_671752
RefSeq Size 8339
RefSeq ORF 4929
Locus ID 217265
Cytogenetics 11|11 E1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.