Rapgef2 (NM_001099624) Mouse Untagged Clone

CAT#: MC224556

Rapgef2 (untagged) - Mouse Rap guanine nucleotide exchange factor (GEF) 2 (Rapgef2), (10ug)

USD 1,896.00


Availability*
8 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rapgef2 (NM_001099624) Mouse Untagged Clone
Symbol Rapgef2
Synonyms 5830453M24Rik; CNRasGEF; mKIAA0313; nRapGEP; Pdzgef1; RA-GEF-1
Vector pCMV6-Entry
Sequence Data
>MC224556 representing NM_001099624
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTTCCTTGTGCGTTGCTATGCCAACTGCCTGCAGCCATGGTCCTCCAAACTCCCTGCAGACTTCA
CAAAACTGCACCTCACTGACAGCCTGCACCCACAGGTGACCCACGTGTCCTCCAGCCATTCAGGATGTAG
CATCACCAGCGACTCTGGGAGCAGCAGTCTTTCTGACATTTACCAGGCCACGGAGAGCGAGGCCGGTGAC
ATGGACCTGAGTGGACTGCCAGAGACGGCGGTTGACTCTGAGGATGACGATGATGAGGAAGACATCGAGA
GAGCATCAGACCCTCTGATGAGCAGGGACATCGTGAGGGACTGCCTGGAGAAGGACCCGATAGACAGGAC
TGACGATGACATCGAACAACTACTGGAATTTATGCACCAGCTGCCGGCCTTTGCCAATATGACGATGTCA
GTAAGACGGGAGCTCTGTGCCGTGATGGTGTTTGCAGTGGTGGAAAGAGCTGGAACCATTGTGTTAAACG
ACGGAGAAGAGCTGGATTCCTGGTCAGTGATTCTCAATGGTTCCGTGGAGGTGACATATCCGGATGGGAA
AGCAGAAATTCTGTGCATGGGAAACAGCTTTGGTGTTTCGCCCACCATGGACAAAGAATACATGAAAGGA
GTCATGAGGACTAAGGTGGATGACTGCCAGTTTGTCTGCATTGCCCAGCAAGATTACTGCCGTATTTTGA
ACCAAGTAGAAAAGAACATGCAAAAAGTTGAGGAGGAAGGAGAGATTGTAATGGTGAAGGAGCACCGAGA
ACTTGATCGGACTGGAACAAGGAAGGGCCACATCGTCATCAAGGGCACCTCAGAGAGGCTGACCATGCAT
TTGGTGGAAGAGCATTCTGTAGTGGATCCAACATTCATAGAAGACTTCCTGTTGACATACCGGACTTTCC
TTTCCAGCCCGATGGAAGTGGGCAAGAAGTTATTGGAGTGGTTCAATGACCCGAGCCTCAGGGATAAGGT
GACGCGGGTAGTATTACTGTGGGTGAATAATCACTTCAATGACTTTGAAGGGGATCCTGCAATGACTCGA
TTTCTGGAAGAATTTGAAAATAATCTGGAAAGAGAGAAAATGGGTGGACATCTAAGGCTGTTGAACATTG
CATGTGCAGCTAAAGCCAAACGAAGACTGATGACGTTAACAAAGCCTTCCCGGGAAGCCCCTCTGCCCTT
CATCTTACTGGGAGGCTCTGAAAAGGGCTTTGGCATCTTCGTGGACAGCGTTGACTCGTGTAGCAAAGCC
ACTGAAGCAGGCTTGAAGCGCGGGGATCAGATATTAGAAGTGAATGGTCAAAATTTTGAAAATATCCAAC
TTTCAAAGGCAATGGAAATTCTCAGAAATAACACACACCTGTCCATCACTGTGAAAACCAACTTATTTGT
ATTTAAAGAACTTCTGACGAGATTGTCTGAAGAGAAAAGAAACGGTGCCCCTCACCTCCCTAAAATCGGG
GACATCAAGAAGGCCAGCCGCTACTCCATACCGGATCTCGCCGTAGACGTAGAACAGGTGATAGGCCTCG
AGAAGGTCAACAAGAAAAGCAAAGCCAACACCGTGGGAGGAAGAAACAAGCTGAAGAAAATACTCGACAA
GACCCGGATCAGCATCTTACCTCAGAAACCATACAATGATATTGGGATTGGTCAGTCTCAAGATGATAGC
ATCGTAGGACTGAGGCAGACCAAGCACATCCCAGCTGCCCTGCCTGTCAGTGGAACGCTGTCCTCCAGTA
ACCCTGACTTGCTGCAGTCACACCACCGGATTCTGGACTTCAGCACTACTCCTGACTTGCCAGATCAGGT
ACTGAGAGTTTTCAAGGCTGACCAACAAAGCAGGTACATCATGATCAGCAAGGACACCACCGCAAAGGAA
GTGGTCATCCAGGCCATCAGAGAGTTTGCTGTCACTGCCACCCCAGAGCAGTATTCCCTCTGTGAGGTCT
CAGTCACACCAGAGGGAGTTATCAAACAACGCCGACTCCCAGATCAGCTTTCCAAGCTTGCCGACAGGAT
ACAACTGAGTGGAAGGTATTATCTGAAAAACAACATGGAAACAGAAACGCTTTGCTCAGATGAAGATGCC
CAGGAGCTGCTGCGAGAGAGCCAAATCTCCCTCCTTCAGCTCAGCACCGTGGAGGTTGCCACGCAGCTCT
CCATGAGGAACTTTGAACTCTTCCGCAACATTGAGCCTACTGAATACATAGATGATTTATTTAAACTCAA
ATCAAAAACCAGCTGTGCCAACCTGAAGAAATTTGAGGAAGTCATTAACCAGGAAACATTTTGGGTGGCT
TCTGAAATCCTGCGGGAAACAAACCAGCTGAAGAGGATGAAGATCATTAAGCATTTCATCAAGATTGCCT
TGCACTGCAGGGAATGCAAGAATTTTAACTCCATGTTTGCAATCATCAGTGGCCTAAACCTGGCACCGGT
GGCAAGACTACGAACCACCTGGGAAAAGCTTCCCAATAAATATGAAAAGCTGTTCCAGGACCTGCAAGAC
CTGTTTGATCCTTCCAGAAACATGGCAAAGTACCGCAATGTCCTGAGTGGCCAGAACTTACAGCCTCCTG
TCATTCCCCTGTTCCCTGTCATCAAGAAGGACCTCACGTTTCTCCATGAGGGAAATGACTCAAAAGTAGA
CGGACTGGTCAACTTTGAGAAGCTGAGGATGATTGCAAAAGAAATCCGTCACGTTGGCCGAATGGCATCA
GTCAACATGGACCCTGCCCTTATGTTCAGGACTCGGAAGAAGAAGTGGCGGAGTCTGGGGTCCCTGAGTC
AGGGCAGTGCAAACGCCACAGTGCTGGATGTTGCTCAGACAGGCGGGCATAAAAAGCGGGTACGCCGTAG
TTCCTTCCTCAATGCCAAAAAGCTGTATGAAGATGCCCAGATGGCTCGGAAAGTGAAGCAATACCTGTCC
AACCTGGAGCTGGAGATGGATGAGGAGAGTCTTCAGACACTGTCACTGCAGTGTGAACCAGCAACCAGCA
CATTGCCCAAGAATCCTGGAGACAAAAAGCCTGTCAAGTCTGAGACCTCCCCAGTGGCTCCACGTGCAGG
GCCCCAGCAGAAAGTACAGCCTCAGCAGCCGCTGGCACAGCCACAACCTCCACATAAAGTCAGCCAGGGA
CTGCAGGTGCCCGCTGTGTCCCTCTATCCTTCACGAAAGAAGGTGCCGGTGAAGGATCTGCCTCCTTTTG
GCATAAACTCTCCACAAGCTTTGAAGAAAATCCTGTCCTTGTCTGAAGAAGGGAGTTTGGAGCGTCACAG
GAAGCAAGCAGAAGATACAATATCAAATGCGTCCTCTCAGCTCTCATCGCCCCCCACCTCACCTCAGAGC
TCTCCAAGGAAAGGTTATGCACTGGCTCTCAGTGGCACCGTGGATAATTTCTCAGATTCAGGTCACAGTG
AGATTTCTTCACGATCCAGTATTGTCAGCAATTCTTCTTTTGACTCGGTGCCAGTCTCTCTGCATGATGA
ACGGCGCCAGAGGCATTCTGTCAGCATTGTGGAGAGCAACCTAGGTGTGGGCAGGATGGAGCGGCGGACC
CTGATGGAGCCTGATCAATACAGCTTAGGGTCGTATGCCCCAGTGTCTGAAAGCCGAGGCCTGTATGCCG
CAGCGACGGTCATCTCTTCTCCTAGCACAGAGGAGCTTTCCCATGACCAAGGGGACCGTGCTTCCCTCGA
TGCTGCTGACAGCGGTCGTGGGAGCTGGACATCATGCTCAAGTGGTTCCCATGACAACATACAGACCATT
CAGCACCAGAGAAGCTGGGAAACACTGCCATTTGGGCACACTCACTTTGACTATTCAGGGGATGCTGCAA
GTATATGGGCCTCCGGTGGCCATATGGACCAAATGATGTTTTCTGATCATAGCACAAAATATAACAGACA
GAATCAAAGTAGAGAGAGTCTTGAACAAGCCCAATCCCGGGCCAGCTGGGCGTCTTCCACGGGCTACTGG
GGAGAAGACTCAGAAGGCGACACAGGCACTATCAAGCGAAGGGGTGGGAAGGATGTCTCCGCTGAGGCAG
AGAGCAGCAGCATGGTGCCCGTGACTACAGAGGAAGCCAAACCTGTCCCTATGCCTGCCCACATAGCTGT
GACGCCGAGCACTACCAAGGGACTCATCGCACGGAAGGAAGGCAGGTACCGGGAGCCGCCTCCCACACCT
CCAGGCTACGTGGGCATCCCCATTGCCGATTTCCCAGAAGGGCCTTGCCACCCGGCCAGGAAGCCCCCGG
ATTACAACGTGGCCCTGCAGCGGTCCCGCATGGTGGCACGGCCCACTGAGGCCCCGGCACCGGGCCAGAC
GCCGCCTGCAGCCGCAGCCAGCCGGCCGGGCAGCAAGCCACAGTGGCACAAGCCCAGCGACGCAGACCCA
CGCCTCGCGCCCTTCCAGCCGCAGGGCTTCGCAGGAGCGGAGGAGGACGAAGATGAACAAGTGTCTGCTG
TTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001099624
ORF Size 4485 bp
Insert Size 4485
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001099624.3, NP_001093094
RefSeq Size 6583
RefSeq ORF 4485
Locus ID 76089
Cytogenetics 3|3 E3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.