Ncoa2 (NM_008678) Mouse Untagged Clone

CAT#: MC224515

Ncoa2 (untagged) - Mouse nuclear receptor coactivator 2 (Ncoa2), transcript variant 1, (10ug)

USD 1,865.00


Availability*
7 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ncoa2 (NM_008678) Mouse Untagged Clone
Symbol Ncoa2
Synonyms bHLHe75; D1Ertd433e; GRIP-1; Grip1; KAT13C; NCoA-2; SRC-2; TIF2
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC224515 representing NM_008678
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGGGATGGGAGAAAACACCTCTGACCCGTCCAGGGCAGAGACCAGAAAACGCAAGGAATGTCCCG
ACCAGCTCGGACCCAGCCCCAAAAGGAGCACTGAGAAACGGAACCGCGAGCAGGAGAATAAGTACATAGA
GGAGCTGGCCGAGCTGATCTTCGCAAACTTTAATGATATTGACAACTTCAACTTCAAACCTGACAAATGT
GCCATCCTAAAAGAAACTGTGAAGCAGATCCGCCAGATCAAAGAGCAAGAGAAAGCAGCAGCTGCCAACA
TAGATGAAGTGCAGAAGTCAGATGTGTCGTCCACGGGGCAGGGTGTCATCGACAAGGATGCACTGGGGCC
CATGATGCTTGAGGCCCTCGATGGGTTCTTCTTCGTTGTGAACCTGGAAGGCAGTGTGGTGTTCGTGTCA
GAGAATGTGACACAGTATCTACGGTATAACCAAGAAGAGCTGATGAACAAGAGTGTCTACAGCATCCTGC
ATGTCGGGGACCACACTGAATTTGTCAAGAACCTGCTGCCAAAGTCCATGGTGAATGGAGGATCCTGGTC
TGGAGAACCTCCCAGGCGGAGCAGCCATACCTTCAACTGTCGCATGCTGGTGAAGCCTTTGCCAGATTCA
GAAGAGGAAGGCCATGATAGCCAGGAAGCCCATCAGAAATACGAGGCGATGCAGTGCTTCGCTGTGTCTC
AGCCCAAGTCCATCAAAGAGGAAGGCGAAGATTTGCAGTCCTGCTTGATTTGTGTGGCACGAAGAGTCCC
CATGAAGGAAAGACCAACTCTTCCCTCATCAGAAAGCTTTACCACCCGCCAGGACCTCCAAGGCAAGATC
ACTTCACTGGACACTAGCACCATGAGAGCCGCCATGAAGCCGGGCTGGGAAGATCTGGTAAGAAGATGCA
TTCAGAAGTTCCACACACAGCATGAAGGGGAGTCTCTATCATATGCCAAGAGGCATCACCATGAAGTTCT
GAGACAAGGGTTGGCGTTCAGTCAGATCTATCGTTTTTCTTTGTCTGATGGCACTCTCGTTGCTGCACAA
ACCAAGAGCAAACTCATCCGTTCTCAGACTACTAATGAGCCTCAGCTTGTAATATCTTTACACATGCTTC
ACAGAGAGCAGAATGTATGTGTAATGAATCCGGATCTGACTGGACAAGCGATGGGGAAGCCATTGAATCC
AATTAGCTCTAGCAGCCCTGCCCACCAGGCCCTGTGCAGTGGGAACCCAGGTCAGGACATGACCCTCGGT
AGCAATATAAATTTTCCCATGAATGGCCCAAAGGAACAAATGGGCATGCCTATGGGCAGGTTTGGTGGTT
CTGGGGGCATGAACCATGTGTCAGGCATGCAAGCAACCACTCCTCAGGGTAGTAACTATGCACTCAAAAT
GAACAGTCCCTCGCAAAGCAGCCCCGGCATGAACCCGGGGCAAGCCAGCTCCGTGCTCTCCCCAAGGCAG
CGCATGAGCCCCGGCGTGGCTGGCAGTCCTCGCATCCCACCCAGTCAGTTTTCCCCTGCAGGAAGCTTGC
ATTCCCCTGTGGGAGTTTGCAGCAGCACAGGAAATAGCCATAGTTATACCAACAGTTCCCTCAATGCACT
GCAAGCCCTCAGCGAGGGCCATGGGGTCTCACTCGGGTCCTCGCTGGCTTCACCGGACCTAAAAATGGGC
AATTTGCAAAACTCCCCAGTTAATATGAATCCTCCCCCACTCAGCAAGATGGGAAGCTTGGACTCCAAAG
ACTGTTTTGGACTTTATGGGGAGCCCTCAGAAGGTACAACTGGACAAGCAGAGGCCAGCTGCCATCCTGA
AGAACAAAAGGGGCCCAATGATTCCAGCATGCCCCAGGCGGCCAGCGGGGACAGGGCTGAGGGACACAGC
CGGCTGCATGACAGCAAAGGGCAGACCAAACTCCTGCAGCTGCTGACCACCAAGTCCGACCAGATGGAGC
CTTCACCCTTGCCCAGCTCCTTGTCGGACACAAACAAGGACTCAACAGGGAGCTTGCCTGGGCCTGGGTC
CACGCATGGCACCTCGCTCAAGGAGAAGCATAAGATTTTGCACAGACTCTTACAGGACAGCAGTTCCCCT
GTGGACTTGGCCAAGCTGACAGCAGAAGCCACAGGCAAAGAGCTGAGCCAGGAGTCCAGCAGCACAGCTC
CTGGGTCGGAAGTGACTGTCAAACAGGAGCCAGCGAGCCCCAAGAAGAAAGAGAATGCACTACTGCGCTA
TTTGCTCGACAAAGATGATACTAAAGATATTGGTTTACCGGAAATAACCCCCAAACTCGAGCGACTGGAC
AGTAAGACAGATCCTGCCAGTAACACAAAGTTAATTGCTATGAAAACTGTGAAGGAGGAGGTGAGCTTTG
AGCCCAGTGACCAGCCTGGCAGCGAGCTGGACAACTTGGAAGAGATTTTGGATGATTTGCAGAACAGTCA
GTTACCACAGCTTTTCCCAGACACAAGGCCAGGAGCTCCTACTGGGTCAGTTGACAAGCAAGCCATCATC
AATGACCTCATGCAACTCACAGCTGACAGCAGTCCCGTCCCACCTGCCGGAGCCCAGAAGGCAGCACTGC
GCATGTCACAGAGCACTTTTAATAACCCACGACCAGGGCAACTGGGCAGGTTATTGCCAAACCAGAACTT
ACCACTTGACATCACTTTGCAAAGCCCAACTGGTGCTGGACCTTTCCCACCAATCAGAAACAGTAGCCCC
TACTCAGTGATACCTCAGCCAGGAATGATGGGTAACCAAGGGATGCTAGGAAGCCAAGGAAACTTAGGGA
ACAATAGCACAGGAATGATTGGCAGCAGCACTTCCCGGCCCAGCATGCCTTCTGGGGAATGGGCACCACA
GAGTCCAGCTGTGAGAGTCACTTGTGCTGCTACCACTGGTGCCATGAACCGACCAGTCCAAGGAGGCATG
ATTCGGAACCCAACAGCCAGCATCCCCATGCGAGCCAACAGCCAGCCTGGCCAAAGACAGATGCTTCAGT
CTCAGGTCATGAACATAGGCCCTTCTGAGTTAGAGATGAACATGGGAGGACCTCAGTATAATCAACAGCA
GGCCCCTCCGAACCAAACTGCCCCGTGGCCTGAGAGCATCCTGCCTATAGACCAGGCATCGTTTGCCAGC
CAGAACAGGCAGCCCTTCGGCAGCTCCCCTGATGACCTGCTGTGTCCACATCCTGCAGCAGAGTCGCCAA
GCGATGAGGGCGCTCTTCTTGACCAGCTGTATCTGGCCTTGCGGAACTTCGATGGCCTTGAGGAGATTGA
TAGAGCTCTGGGGATACCAGAACTGGTCAGCCAGAGCCAAGCTGTGGATGCAGAGCAGTTCTCAAGTCAG
GAGTCCAGCATAATGCTGGAGCAGAAGCCCCCCGTTTTCCCACAGCAGTACGCATCTCAGGCACAAATGG
CCCAGGGTGGCTATAATCCCATGCAAGATCCAAACTTTCACACCATGGGACAGCGGCCAAATTACACCAC
ACTCCGTATGCAGCCACGGCCAGGCCTCAGGCCCACAGGCATTGTGCAGAACCAGCCAAACCAACTGAGA
CTTCAGCTTCAGCACCGCCTCCAAGCACAGCAGAATCGCCAGCCGCTTATGAATCAGATCAGCAGTGTTT
CCAATGTGAACCTGACTCTGAGGCCTGGAGTGCCCACTCAGGCTCCTATTAATGCACAGATGCTGGCCCA
GAGGCAGAGGGAAATCCTCAACCAACATCTTCGGCAGAGACAGATGCAGCAGCAGGTGCAGCAGCGGACT
TTGATGATGAGAGGACAGGGCTTGAATGTGACCCCAAGCATGGTGGCTCCCGCTGGCCTACCAGCAGCCA
TGAGCAATCCCCGGATCCCCCAGGCCAATGCCCAGCAGTTCCCATTTCCTCCGAACTACGGAATAAGTCA
ACAACCTGATCCTGGCTTTACTGGGGCTACAACTCCCCAGAGTCCTCTAATGTCTCCCCGGATGGCACAT
ACTCAGAGTCCCATGATGCAGCAGTCTCAAGCCAACCCAGCCTACCAGCCCACCTCAGACATGAATGGAT
GGGCACAGGGGAGCATGGGTGGAAACAGCATGTTCTCACAGCAGTCCCCACCACACTTTGGGCAACAAGC
AAACACCAGCATGTATAGTAACAACATGAACATCAGTGTGTCGATGGCAACCAACACGGGTGGCTTGAGC
AGCATGAACCAGATGACAGGCCAGATGAGCATGACCTCAGTGACCTCCGTGCCTACGTCAGGACTGCCCT
CCATGGGTCCCGAGCAGGTCAATGACCCTGCTCTGAGGGGAGGCAACCTTTTCCCAAACCAACTGCCTGG
AATGGACATGATCAAGCAGGAGGGAGATGCATCTCGGAAATACTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_008678
ORF Size 4389 bp
Insert Size 4389
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_008678.3, NP_032704
RefSeq Size 8286
RefSeq ORF 4389
Locus ID 17978
Cytogenetics 1 A3|1 4.12 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.