Naip2 (NM_010872) Mouse Untagged Clone

CAT#: MC224481

Naip2 (untagged) - Mouse NLR family, apoptosis inhibitory protein 2 (Naip2), transcript variant 1, (10ug)

USD 1,844.00


Availability*
8 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Naip2 (NM_010872) Mouse Untagged Clone
Symbol Naip2
Synonyms Birc1b; Naip-rs6
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC224481 representing NM_010872
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGCCCAGGGAGAAGCCGTTGAGGAGATAATTTGTGAGTTTGATGACGACTTGGTCTCTGAGCTCT
CTACTCTTCTCAGAGTGGATGCACTTTCAGTCTTGAAGAGACAACAAGAAGAAGACCATAAAACACGAAT
GAAAATGAAGAAAGGTTTTAACTCACAGATGCGCAGTGAAGCCAAACGACTAAAGACTTTTGAGACCTAT
GACAAGTTCAGATCATGGACGCCACAGGAGATGGCAGCTGCTGGGTTTTACCACACAGGGGTGAAACTTG
GGGTTCAGTGCTTTTGCTGTAGCTTGATCCTCTTTTCCACCAGACTCAGGAAACTTCCCATAGAGAACCA
CAAGAAATTACGACCAGAATGTGAGTTCCTTCTGGGCAAAGATGTTGGTAACATTGGCAAGTATGACATC
CGGGTTAAGAGTCCAGAGAAGATGCTGAGAGGTGACAAAGCAAGGTACCATGAAGAGGAGGCAAGACTGG
AGTCCTTTGAGGACTGGCCATTTTATGCCCATGGGACATCACCACGTGTACTCTCAGCAGCTGGCTTTGT
CTTTACAGGTAAAAGGGACACTGTGCAGTGTTTCTCCTGTGGTGGATGCTTGGGCAACTGGGAAGAAGGA
GATGATCCCTGGAAGGAGCATGCCAAGTGGTTCCCCAAATGTGAATTTCTTCAAAGTAAGAAGTCCCCAG
AGGAAATTACCCAATATGTACAAAGCTATGAAGGATTTCTTCATGTAACGGGAGAACATTTTGTGAATTC
CTGGGTCAGAAGAGAATTACCTATGGTATCAGCTTACTGCAATGACAGCGTCTTCGCTAATGAAGAACTA
AGGATGGACACGTTTAAGGACTGGCCCCACGAATCACCCGGGGCTGTTGAAGCTCTGGTCAAAGCAGGCC
TTTTCTACACAGGCAAAAGGGACATTGTCCAGTGTTTTTCCTGTGGAGGATGTATGGAGAAGTGGGCAGA
AGGTGACAACCCAATAGAAGATCACACCAAGTTTTTTCCCAACTGTGTGTTTCTCCAAACCCTGAAGTCC
TCTGCAGAAGTGATTCCAGCCCTTCAGAGCCACTGTGCACTTCCAGAAGCCATGGAAACCACAAGTGAAA
GCAACCATGATGATGCAGCAGCAGTTCATTCTACAGTGGTGGATGTTTCTCCAAGTGAAGCCCAGGAACT
TGAACCTGCATCCAGCTTGGTGTCTGTTCTCTGTAGAGACCAGGACCACAGTGAAGCCCAAGGGCGTGGA
TGTGCATCCAGTGGGACCTATCTTCCCTCCACAGACTTGGGTCAGAGTGAAGCCCAGTGGCTTCAAGAGG
CCAGGAGTCTGAGTGAGCAGCTGAGAGACACCTACACCAAAGCTACTTTCCGCCACATGAACTTGCCAGA
AGTGTACTCCAGCCTCGGCACTGACCATTTGCTCAGCTGCGATGTGTCCATCATTTCAAAGCACATCAGC
CAGCCAGTGCAAGGGTCCCTGACGATCCCTGAGGTCTTCTCCAATCTCAACTCTGTCATGTGTGTGGAGG
GGGAAGCTGGCAGTGGAAAGACAACCTTCCTGAAGAGGATAGCTTTTCTCTGGGCATCAGGATGCTGCCC
CCTGTTGTACAGGTTCCAGCTGGTCTTCTACCTCTCCCTTAGTTCCATCACACCAGGCCAGGAACTGGCC
AAAATCATCTGTGCCCAACTCCTAGGGGCAGGAGGCTGCATTAGTGAAGTGTGTCTGAGCAGCATCATCC
AGCAGTTACAACACCAGGTGCTGTTCCTGTTGGATGACTACAGTGGGCTGGCCTCACTCCCCCAAGCCCT
ACACACACTGATTACAAAAAACTACTTGTCACGGACCTGCTTATTGATCGCTGTGCATACAAACAAGGTC
AGGGGCATCCGCCCATACCTAGATACGAGTCTAGAGATCAAAGAGTTTCCCTTCTATAATACTGTCTCTG
TGTTACGGAAGCTTTTTTCACATGACATAATGCGTGTACGAAAATTTATAAATTACTTTGGATTTCATGA
AGAGTTGCAGGGAATTCACAAGACACCCCTCTTCGTGGCAGCAGTATGTACTGACTGGTTTAAAAATCCA
TCTGACCAGCCCTTTCAGGATGTGGCACTTTTCAAGGCCTATATGCAATACTTGTCCTTAAAGCACAAAG
GTGCAGCTAAGCCTCTCCAGGCCACAGTGTCCTCATGTGGGCAGCTGGCCTTGACAGGGCTTTTCTCATC
GTGCTTTGAGTTCAATAGTGATAACCTGGCAGAGGCAGGAGTTGATGAAGATGAAGAGCTCACCACCTGC
TTGATGAGCAAATTCACCGCCCAGAGACTGAGGCCAGTCTACCGGTTTTTAGGTCCTCTGTTCCAGGAGT
TTCTTGCTGCCGTGAGGTTGACTGAACTCCTGAGTTCAGATAGGCAGGAAGACCAAGATCTGGGACTTTA
TTATTTGAGACAAATTAACTCACCTCTAAAGGCTATGAGCATCTACCACACTTTTTTGAAATATGTCTCC
AGCCACCCTTCATCAAAGGCAGCGCCAACAGTTGTATCTCATTTGCTTCAGTTGGTGGATGAGAAAGAGT
CACTGGAGAACATGTCTGAAAATGAGGATTACATGAAGCTCCATCCAGAAGCTTTGCTGTGGATTGAGTG
TCTTAGAGGATTGTGGCAGCTGTCTCCTGAATCTTTTTCTTTGTTCATTTCAGAAAACTTATTGCGCATT
TGTCTAAACTTTGCTCATGAAAGCAACACAGTTGCTGCATGTTCTCCAGTTATTTTGCAGTTCCTTCGAG
GGAGAACACTGGATTTGAAAGTTTTGAGTTTACAGTACTTTTGGGACCATCCAGAAACCTTGTTGTTATT
GAAGAGTATTAAGATCTCATTAAATGGAAATAACTGGGTACAGAGAATCGATTTTTCACTCATAGAAAAA
TCTTTTGAAAAAGTACAGCCACCAACTATAGATCAGGACTATGCCATTGCCTTTCAACCTATAAATGAAG
TCCAGAAAAATTTATCTGAAAAGAAACACATAATAAAGAAGTATGAGGATATGAAACACCAGATCCCACT
AAATATTAGTACTGGCTACTGGAAACTGTCCCCCAAGCCATACAAGATCCCCAAGCTGGAAGTTCAAGTG
ACCAACACAGGTCCAGCAGATCAAGCACTGCTCCAGGTCCTCATGGAAGTCTTCTCAGCTTCACAGAGTA
TTGAGTTCCGTTTATCCGACAGCAGTGGCTTCCTTGAAAGCATCCGCCCAGCTCTGGAGCTGAGTAAGGC
CTCTGTCACCAAGTGTTCCATGTCCAGGCTGGAGCTCAGCAGAGAAGATCAGAAGCTGCTTCTCACCCTG
CCTACCCTGCAGTCTCTCGAGGTCTCAGAGACAAACCAGTTACCAGATCAGCTCTTCCATAACTTGCACA
AGTTCCTGGGCCTGAAAGAACTGTGTGTGAGACTAGATAGCAAGCCGGATGTGCTCTCAGTCCTTCCTGG
AGAGTTCCCAAACCTCCATCACATGGAGAAGTTATCCATCAGAACCTCCACGGAGTCTGACCTCTCCAAA
CTAGTTAAGTTGATTCAGAACTCTCCAAATCTCCATGTTTTCCATCTGAAGTGTAATTTCCTTTCGAATT
GTGAGCCTCTCATGACTGTGCTTGCTTCCTGCAAGAAACTCAGAGAGATTGAGTTTTCTGGACGATGCTT
TGAAGCCATGACCTTTGTCAACATTTTGCCAAATTTTGTTTTTCTGAAGATATTGAATCTTAGAGACCAA
CAATTCCCAGATAAAGAAACATCAGAAAAGTTTGCCCAGGCTCTGGGTTCTCTCAGGAACCTGGAGAAAC
TGTTCGTTCCCACTGGGGACGGGATTCACCAAGTGGCCAAACTGATTGTCCGGCAGTGTCTGCAGCTCCC
ATGTCTCCGAGTTCTTGTCTTTGCAGAGACTCTGGATGACGACAGTGTACTGGAAATTGCCAAGGGAGCA
ACCAGGGGAGGCTTCCAAAAACTTGAGAACTTAGACCTTACACTGAATCACAAGATTACAGAGGAAGGAT
ACAGAAATTTCTTTCAAGTCCTGGACAACCTGCCAAACCTGAAAAACCTGGACATTTCCAGGCATATCCC
AGAATGCATTCAAATTCAGGCCATCACTGTCAAGGCTCTGGGTCAGTGTGTGTCCCGACTGCCCAGCCTC
ACCAGGCTCGGGATGCTCAGTTGGCTCCTGGATGAAGAGGACATAAAAGTGATTAATGATGTGAAGGAAA
GACACCCTCAGTCCAAACGCTTGACTGTTCACTGGAGGTGGGTAGTGCCATTCTCTCCTGTCATTCAGAA
GTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_010872
ORF Size 4344 bp
Insert Size 4344
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_010872.3, NP_035002
RefSeq Size 4853
RefSeq ORF 4344
Locus ID 17948
Cytogenetics 13 D1|13 53.01 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.