Arap1 (NM_001040111) Mouse Untagged Clone

CAT#: MC224470

Arap1 (untagged) - Mouse ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (Arap1), transcript variant 3, (10ug)

USD 1,834.00


Availability*
7 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Arap1 (NM_001040111) Mouse Untagged Clone
Symbol Arap1
Synonyms 2410002L19Rik; Centd2; mKIAA0782
Vector pCMV6-Entry
Sequence Data
>MC224470 representing NM_001040111
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGAGGGTTACGATGCCGCACTGTCTGTAGCTGAGTGGCTGCGGGCACTTCACCTGGAGCAGTACA
CGGCACTCTTTGAGCAGCACGGACTGGTGTGGGCCACCGAGTGCCAAGGCCTCAGCGATGCTGGCCTGCT
AGACATGGGCATGCACCTCCCCGGCCACCGCCGCCGCATCCTGGCTGGTCTTCACCGCGCCCATGCACCC
CCAGTCCCTCTGCCTCGCCCCGCCCCACGGCCCGTGCCGATGAAGCGACACATCTTCCGTTCACCACCTG
TGCCCGTCACTCCACCAGAGCCGCCGCCCACAGCTGGAGAGGATGAGGGTCTGCCTGCCGCTCCACCTAT
CCCACCCCGCAGGAGCTGCCTCCCACCTGCCTGCTTCACTCCGACATCCACAGCCGCCCCAGATCCTGTG
CTGCCCCCACTGCCTGCCAAGAGACACTTGGTAGAACCCAGCGTTCCTCCTGTCCCTCCTCGAACCGGAC
CCCCCTACCCACAGGCCAGCCTTCTTGCTAAGGAGGAGTTACTGCTGCCATCAGTGTCACCCCGGTCCCA
ACCAGAGCCTGCAGAGACTCCGTCCACCCTCCTGCCTGCCTTTCCCCAGGGGCCCCTGCAGCCTCCGTCT
CCTCCTCCCTGTCCTCCTGTGATCCCTCCCAAGCCTCCTCGCCTGCTCCCTGAGTTTGACGACTCTGACT
ATGATGATGTCCCGGAGGAGGGGCCAGGGGCCCCAGCCAGTGTGATGACCAAGGAGGAGCCCCTGCCGAG
CCGAGTCCCACGGGCTGTGCGTGTGGCTAGTCTGCTGAGCGAGGGGGAGGAGCTGTCTGGGGATGATTCG
GAAGATGACGATGACCATGCCTATGAGGGTATCCCCAATGGTGGGTGGCCAACGAGTGGCCTGAATCCAC
CCTTACGCAGCCTGATCCCTGATCTCCCACTGCACCCCATGGATGAGTTGCCTGGGGGTCCCACCCCCAT
CACACCTGTCATCAAGGCTGGCTGGCTGGACAAGAACCCACCACAGGGGTCTTATATCTATCAGAAGCGA
TGGGTGAGACTGGACGCTGATTACCTGCGATACTTTGACAGTAACAAGGACGCCTACTCTAAGCGCTTTG
TTCCTGTGGCCTGCATCTGCCGAGTAGCTCCTATTGGAGACCAGAAGTTTGAAGTGATCACAAATAATCG
GACCTTCGCCTTCCGGGCAGAGAGTGATGTGGAGCGGAACGAGTGGATGCAGGCCCTGCAGCAGGCAGTA
GTTGAGCATCGAGCCCGTTTTCGGCTTTCTAGTGCTTCTGTGTTGGGAGTCCGAGGCTCCGAGCAGCCTG
ACCGTGCTGGCAGCCTGGAGCTACGAGGCTTCAAGAATAAGCTTTACGTGGCTGTGACTGGGGACAAAGT
ACAGCTCTATAAGAATCTGGAGGAATTCCATCTGGGCATTGGTATCACCTTTATCGACATGAATGTGGGC
AATGTCAAGGAAGTGGATCGGCGCAGCTTTGACCTCACTACCCCCTACCGCATCTTCAGCTTCTCGGCTG
ATTCAGAGTTAGAGAAGGAACAGTGGCTGGAGGCCATGCAGGGAGCCATCGCAGAGGCCCTATCTACCTC
AGAGGTGGCTGAGCGCATCTGGGCCGCAGCCCCCAACAGGTTCTGTGCCGACTGTGGGGCCGCCCAGCCT
GACTGGGCCTCCATCAACCTCTGCGTTGTCATCTGCAAGCGCTGTGCAGGGGAGCACCGCGGCCTGGGTG
CAGGAGTGTCCAAGGTGCGGAGTTTGAAGATGGACAGGAAGGTGTGGACAGAAGCACTCATCCAGCTCTT
CTTACATCTGGGCAATGGCCCCGGGAACCACTTCTGGGCTGCTAATGTGCCTCCTAGTGAGGCCCTGGAG
CCCAGCAGCAGCCCTGGTGCCCGGCGGTATCACCTGGAGGCCAAGTACAGAGAGGGCAAGTACCGCCGCT
ACCATCCGCTCTTTGGCAACCAAGAGGAACTGGACAAGGCCCTGTGTGCTGCAGTTACTACCACTGACCT
GGCTGAGACCCAGGCACTCCTGGGCTGTGGGGCTGGGGTCAGCTGCTTCTCAGGGGACCCAGCAGCTCCC
ACACCCCTGGCTCTTGCTGAGCAGGCCGGACAGACTCTGCAGATGGAGTTTCTACGGAATAATCAGAGTA
CAGAGGTCCCTCGGTTGGACTCAGTGAAGCCCTTGGAAAAGCACTACTCCGTTACCCTGCCAACTGTGAG
CCACAGCGGCTTCCTGTACAAAACTGCTTCTGCCGGCAAACCTCTGCAGGACCGCCGTGCCCGGGAAGAG
TTCAGCCGGCGCTGGTGTGTCCTGAGTGATGGGGTCCTGAGCTACTATGAAAACGAACGGGCAGTGACAC
CCAATGGGGAGATTCGGGCCAGCGAGATAGTATGCCTAGCAGTTTCCCCTCTGGACACCCATGGCTTTGA
GCACACCTTTGAGGTGTACACAGAGGGAGAACGGCTGTACCTGTTTGGGCTGGAGAATGCAGAGCTGGCT
CATGAGTGGGTCAAGTGCATTGCCAAGGCGTTCGTGCCTCCCCTGGCTGAGGACCTGCTAGCCCGGGACT
TTGAACGTCTTGGGCGCCTACCCTGTAAAGCTGGCCTGAGCCTTCAGCAGGCTCAGGAAGGCTGGTTTGC
CTTGACTGGCTCTGAGCTCCGGGCTGTCTTCCCAGAGGGGCCCTGGGAAGAGCCGCTGCAGCTCCGGAAA
CTGCAAGAGCTTTCTATCCAAGGAGACAGCGAGAACCAAGTGCTGGTGCTGGTGGAGCGGAGGAGGACAC
TGTACATCCAGGGTGAGCGGCGGCTGGACTTCATGGCTTGGCTAGGGGTCATCCAGAAAGCAGCAGCCAG
CTTGGGAGACACACTATCAGAACAACAGCTTGGGGACTCGGACATCCCAGTGATTGTGTACCGCTGTGTG
GACTACATCACGCAGTGTGGCTTGACCTCAGAGGGTATCTATCGAAAGTGTGGTCAGACCTCCAAGACTC
AGAGACTGCTAGACAGCCTCCGGCAGGACGCACGCTCTGTGCACCTAAAGGAGGGAGAACAGCACGTGGA
CGACGTCTCCTCTGCACTCAAACGCTTCCTCAGGGACCTGCCCGATGGGCTCTTCACGCGTGCGCAGCGC
CTGGCCTGGCTGGAGGCCTCTGAGATCGAGGATGAGGAAGAAAAGATCTCCAGGTATCGAGAGCTCTTGG
TGCATCTGCCCCCTGTCAACCGGGCCACTGTGAAGGCCCTTATCAGCCATCTGTACTGTGTACAGTGCTT
CTCAGACACAAACCAAATGAACACACACAACCTGGCTATCGTGTTTGGGCCTACACTCTTCCAGACAGAC
GGGCAGGACTACAAGGCCGGCAAGGTGGTGGAAGACCTCATCAACCACTACGTGGTGGTGTTCAGTGTGG
ACGAGGAGGAGCTGAGGAAGCAGAGGGAGGAAGTCACGGCCATCGTGAAGATGCGAGTGGCTGGCACTGC
CAGTGGGACCCAGCATGCTGGCGACTTCATCTGCACAGTCTACCTGGAGGAGAAGAAGGTGGAGACTGAA
CAGCATGTTAAGATCCCAGCATCCATGACTGCAGAGGAGCTTACTCTGGAGATTCTGGACCGCCGCAATG
TGAGCATCAGGGAGAAGGACTACTGGACTTGCTTTGAGGTCAACGAGAAGGAGGAGGCAGAGCGCCCGCT
GCACTTTGCAGAGAAGGTGCTGCCCATTGTCCATGGGCTGGGCATAGACAGCCATCTGGTGGTGAAGAAG
TACCAGTCCATGGAGGCCATGCTGTTGTACTTGGCCAGCCGTGTGGGTGACACCAAGCATGGTATGATGA
AGTTCCGTGAAGACCGCAGCCTCCTGGGTCTGGGGCTACCTTCGGGTGGCTTCCACGATCGCTACTTCAT
TCTCAACAGCAGCTGCCTACGGCTCTACAAGGAGGTCCGGAGTCACCGGCCTGAGAAGGAGTGGCCTGTC
AAGAGCCTCAAAGTCTACCTGGGTGTAAAGAAGAAACTGCGGCCACCTACTTGCTGGGGCTTCACGGTGG
TGCACGAGACAGAAAAGCACGAGAAGCAGCAGTGGTACCTCTGCTGTGACACGCAGATGGAACTTCGAGA
GTGGTTTGCCACCTTCCTCTCTGTGCAGCACGATGGCCTGGTGTGGCCCTCCGAGCCATCTCGAGTGTCC
CGGGCAGTGCCTGAGGTCCGGATGGGCAGTGTATCGCTGATCCCTCTACGAGGCAGTGAAAATGAAATGC
GCCGGAGTGTGGCAGCCTTCACTGCTGACCCCCTTTCCCTTCTCCGCCATGTCTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
Tag Tag Free
ACCN NM_001040111
ORF Size 4326 bp
Insert Size 4326
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001040111.1, NP_001035200
RefSeq Size 5837
RefSeq ORF 4326
Locus ID 69710
Cytogenetics 7|7 E2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.