Med23 (NM_001166416) Mouse Untagged Clone

CAT#: MC224361

Med23 (untagged) - Mouse mediator complex subunit 23 (Med23), transcript variant 1, (10ug)

USD 1,751.00


Availability*
7 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Med23 (NM_001166416) Mouse Untagged Clone
Symbol Med23
Synonyms 130kDa; 3000002A17Rik; Crsp3; ESTM7; mKIAA1216; Sur2; X83317
Vector pCMV6-Entry
Sequence Data
>MC224361 representing NM_001166416
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTACCGATGGAGACGCAACTGCAGAGCATTTTCGAGGAGGTGGTGAAAACAGAAATTATAGAAGAGG
CCTTCCCAGGAATGTTTATGGATACCCCCGAGGATGAAAAAACAAAACTAATTAGCTGCTTGGCGGCCTT
CCGGCAGTTTTGGAGTGGACTTTCTCAGGAGTCTCATGAACAGTGTGTTCAGTGGATTGTTAAATTTATT
CATGGCCAACACAGCCCCAAAAGAATTTCTTTCCTCTATGACTGCTTAGCAATGGCAGTTGAGACTGGTC
TCCTTCCACCCAGGATGGTTTGTGAATCTTTGATAAACTCTGACTCTCTTGAATGGGAAAGAACACAGCT
TTGGGCCTTAACATTTAAGCTGGTTCGGAAAATCATTGGAGGAGTGGATTACAAGGGTGTTCGAGACCTT
CTCAAAGCGATTTTGGAGAAAATCTTGACAATCCCAAATACAGTGAGCTCTGCTGTTGTCCAGCAGCTTC
TGGCAGCAAGAGAGGTTATAGCTTATATCTTAGAACGAAATGCCTGCCTATTGCCGGCCTACTTTGCAGT
CACAGAGATCAGAAAACTATATCCTGAGGGAAAACTTCCACACTGGTTACTAGGAAACTTGGTATCAGAC
TTTGTGGATACCTTCAGGCCCACAGCAAGGATTAACTCCATTTGTGGCCGATGCAGTCTTCTGCCAGTTG
TGAACAACTCGGGAGCCATCTGTAACTCATGGAAACTGGACCCTGCAACTCTGCGATTTCCTTTGAAAGG
CCTTTTGCCATATGATAAGGATCTGTTTGAACCGCAGACTGCTTTGTTGAGATATGTACTGGAGCAACCT
TATTCCAGGGATATGGTCTGCAATATGCTAGGTTTAAATAAGCAGACCTTGAACATTGCTCAGCACAAGC
AGCGCTGCCCTGTGCTGGAGGACCAGTTGGTGGACCTGGTGGTGTACGCCATGGAGAGGTCAGAGACCGA
GGAGAAGTTTGACGATGGGGGAACCAGCCAGCTCCTGTGGCAGCACCTTTCCAGCCAGCTCATTTTCTTT
GTGCTTTTCCAGTTTGCCAGTTTCCCACATATGGTCCTCTCTCTCCACCAGAAGTTAGCAGGGCGAGGAC
TGATTAAAGGGCGAGACCATCTGATGTGGGTGCTGCTGCAGTTCATTTCTGGAAGTATTCAGAAAAATGC
CCTCGCTGACTTCCTCCCTGTCATGAAGCTCTTTGACCTGCTGTACCCGGAGAAGGAGTGTATCCCAGTT
CCTGATATTAACAAACCCCAGTCAACGCACGCCTTTGCAATGACTTGTATTTGGATTCATCTTAATAGAA
AAGCTCAAAATGGCGACTCCACGCTCCAGATCCCAATACCCCATTCCCTGAAGCTGCACCATGAGTTCCT
CCAGCAGAGTCTGAGAAATAAAAGCTTACAGATGAATGACTATAAGATTGCCCTGCTATGTAACGCGTAT
TCCACAAACTCAGAGTGTTTTACGTTACCTATGGGAGCTCTGGTAGAAACTATTTATGGAAATGGAATTA
TGAGAGTGCCTCTCCCTGGAACGAGCTGTTTGGCCTCAGCATCAGTGACTCCCTTACCGATGAACCTCCT
GGATTCACTGACGGTGCATGCCAAGATGAGCCTTATTCACAGCATTGCAACCAGAGTGATAAAACTGGCT
CATACGAAATCCAGTGTTGCGCTGGCTCCAGCCCTAGTGGAAACTTACAGCCGTTTACTGGTCTACATGG
AAATTGAGTCTTTGGGCATCAAAGGATTTATCAGTCAGCTCCTGCCCACTGTCTTCAAGTCCCACGCCTG
GGGCATCCTGCACACACTGCTGGAGATGTTCAGCCACCGAATGCACCACATTCAGCCCCACTACCGAGTT
CAGCTCCTGAGCCATCTCCACACACTGGCTGCAGTCGCACAGACCAACCAGAACCAGCTCCATCTGTGTG
TGGAGAGCACTGCACTGAGGCTCATCACAGCCCTGGGAAGCTCAGAGGTCCAGCCGCAGTTCACGCGTTT
CCTCAATGATCCCAAAACAGTGCTGTCCGCCGAATCTGAAGAGCTGAACCGAGCCTTGATCCTGACCTTA
GCCAGAGCAACCCACGTCACAGATTTTTTTACAGGATCTGATTCAATACAGGGAACTTGGTGTAAAGATA
TCCTTCAGACCATCATGAACTTTACTCCTCATAACTGGGCTTCACATACCCTTAGCTGTTTTCCAGCCCC
TCTGCAGGCTTTCTTCAAGCAAAATAACGTGCCCCAGGAAAGCCGTTTTAATCTGAAGAAGAATGTGGAA
GAAGAGTACAGGAAGTGGAAGTCAATGACTGATGAAAACGAGATCATCACCCAGTTCTCTGTGCAGGGCT
TCCCTCCACTCTTCCTCTGTCTCCTCTGGAAGATGCTCCTGGAGACGGATCATATTAGTCAGATCGGCTA
CAAGGTCCTGGAGAGGATTGGGGCCAGGGCCCTGGTGGCCCATGTGAGAACATTTGCAGATTTCCTGGTG
TATGAGTTCTCTACGTCAGCAGGAGGTCAGCAACTCAATAAGTGCATTGAAATTCTCAACGACATGGTGT
GGAAGTACAACATTGTCACGCTGGACAGACTCATTCTCTGCCTGGCTATGCGTAGTCATGAAGGAAATGA
AGCCCAGGTTTGTTATTTCATAATTCAGTTGCTGTTGCTCAAACCAAATGACTTCAGAAACCGAGTAAGT
GACTTTGTGAAGGAGAATTCCCCAGAGCACTGGCTCCAGAGTGACTGGCACACCAAGCACATGAGCTACC
ACAAGAAATATCCCGAGAAGCTGTATTTTGAAGGCCTGGCAGAGCAGGTTGACCCTCCTGTACCAATCCA
GTCCCCTTATCTGCCCATCTACTTTGGAAATGTGTGTCTCCGGTTCCTTCCAGTATTTGATATAGTAATC
CACAGGTTTTTAGAGTTGCTTCCAGTGTCCAAATCACTAGAGACTCTCCTGGATCACCTAGGGGGCTTAT
ATAAATTCCATGACCGGCCAGTGACTTATCTGTATAATACTTTGCACTATTATGAAATGTGCCTGAGAAA
CCGTGACCATCTCAAACGAAAACTTGTCCATGCAATCATTGGCTCCCTCAAAGATAACCGGCCACAGGGC
TGGTGTCTCAGTGATACCTACCTGAAGCATGCTATGAATGCACGGGAGGACAACCCCTGGGTTCCGGAGG
ACTCCTACTACTGCAAGCTGATTGGCCGACTGGTAGACACCATGGCGGGCAAGTCTCCAGGACCCTTCCC
AAACTGTGACTGGAGATTCAATGAGTTTCCCAACCCCGCTGCCCACGCTCTGCATGTGACGTGTGTGGAA
CTCATGGCCTTGGCGGTTCCAGGCAAAGATGTGGGGAATGCCCTTCTCAATGTCGTCCTGAAAAGCCAGC
CCTTAGTGCCAAGGGAGAACATTACAGCGTGGATGAATGCAATTGGTCTGATCATCACGGCCCTCCCAGA
GCCGTACTGGATTGTGCTTCATGACCGAATTGTGAATGTGATCAGCAGTTCTAGCCTGACGTCAGAGACA
GAGTGGGTCGGTTACCCGTTCCGCCTCTTCGACTTCACCGCTTGTCACCAGTCCTACTCGGAGATGAGCT
GCAGCTATACGTTAGCTCTAGCCCATGCCGTGTGGCACCACTCCAGCATCGGGCAGCTCTCGCTTATCCC
AAAGTTTCTCACTGAGGCGCTTCTCCCGGTGGTGAAGACTGAGTTCCAGTTGCTCTACGTGTACCATCTT
GTGGGGCCATTTCTACAGAGGTTCCAACAGGAGAGAACCCGGTGCATGATTGAGATTGGCGTGGCATTTT
ATGACATGCTGTTGAATGTAGACCAGTGCAGCACGCACTTAAATTACATGGACCCCATCTGCGACTTCCT
GTATCATATGAAGTATATGTTTACTGGTGACAGTGTGAAAGAGCAAGTAGAGAAGATTATCTGTAATTTA
AAGCCGGCTTTAAAGCTTCGTCTTCGATTCATCACGCACATTAGCAAGATGGAGCCGGCAGTGCCACCCC
AGGCCCTCAACAGCGGGTCTCCAGCACCTCAGTCTAACCAGGTGCCAGCATCTCTGCCGGTGACTCAGTG
A


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
Tag Tag Free
ACCN NM_001166416
ORF Size 4131 bp
Insert Size 4131
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001166416.1, NP_001159888
RefSeq Size 4946
RefSeq ORF 4131
Locus ID 70208
Cytogenetics 10 A4|10 12.26 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.